EMAIL THIS PAGE TO A FRIEND

ZSCAN22

zinc finger and SCAN domain containing 22

Synonyms: HKR2 ZNF50
UniProtKB ID: P10073, Q15922, Q7Z3L8
Gene ID:
Mouse(232878) zinc finger and SCAN domain containing 22
Rat(100360280) zinc finger and SCAN domain containing 22
domestic cat(101087184) zinc finger and SCAN domain containing 22
naked mole-rat(101711024) zinc finger and SCAN domain containing 22
Domestic Rabbit(100353977) zinc finger and SCAN domain containing 22
142 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181846 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181846 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181846 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001001447 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001001447 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001001447 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_133180 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_133180 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_133180 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181846 Rosetta Predictions human pricing
NM_001001447 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181846 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177877 predicted 1444
2 SASI_Hs01_00177878 predicted 821
3 SASI_Hs01_00177879 predicted 1717
4 SASI_Hs01_00177880 predicted 1594
5 SASI_Hs01_00177881 predicted 1669
6 SASI_Hs01_00177883 predicted 1778
7 SASI_Hs01_00177884 predicted 1715
8 SASI_Hs01_00177885 predicted 246
9 SASI_Hs01_00177886 predicted 1448
10 SASI_Hs02_00370444 predicted 1446
11 SASI_Hs01_00177882 predicted 1800
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001447 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00139068 predicted 958
2 SASI_Mm01_00139069 predicted 1724
3 SASI_Mm01_00139070 predicted 990
4 SASI_Mm01_00139071 predicted 1156
5 SASI_Mm01_00139072 predicted 1352
6 SASI_Mm01_00139073 predicted 1736
7 SASI_Mm01_00139074 predicted 1783
8 SASI_Mm01_00139075 predicted 631
9 SASI_Mm01_00139076 predicted 1514
10 SASI_Mm02_00286150 predicted 916
11 SASI_Mm01_00139067 predicted 1549
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181846
ZSCAN22 MISSION shRNA Bacterial Glycerol Stock
zinc finger and SCAN domain containing 22
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426827    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181846.2-1898s21c1
Sequence:CCGGGCAGCCGAACTGAGGATTTAGCTCGAGCTAAATCCTCAGTTCGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181846.2-605s21c1
Sequence:CCGGGAGAGTCAGAGCCATCAAATGCTCGAGCATTTGATGGCTCTGACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426251    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181846.2-2078s21c1
Sequence:CCGGGTGCCTTGGCACCTACTATTTCTCGAGAAATAGTAGGTGCCAAGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181846.1-664s1c1
Sequence:CCGGGCCTTTGTCAAGGCATGTGAACTCGAGTTCACATGCCTTGACAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181846.1-870s1c1
Sequence:CCGGGCCTCCTTCAGAAGACAAATTCTCGAGAATTTGTCTTCTGAAGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181846.1-744s1c1
Sequence:CCGGCCAACAGATCCACTTCAAGAACTCGAGTTCTTGAAGTGGATCTGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181846.1-1329s1c1
Sequence:CCGGCCTGACTCAACACCAGCGCATCTCGAGATGCGCTGGTGTTGAGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181846.1-262s1c1
Sequence:CCGGCATGACCACATTGCTCACTCTCTCGAGAGAGTGAGCAATGTGGTCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181846
ZSCAN22 MISSION shRNA shRNA Plasmid DNA
zinc finger and SCAN domain containing 22
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426827    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181846.2-1898s21c1
Sequence:CCGGGCAGCCGAACTGAGGATTTAGCTCGAGCTAAATCCTCAGTTCGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181846.2-605s21c1
Sequence:CCGGGAGAGTCAGAGCCATCAAATGCTCGAGCATTTGATGGCTCTGACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426251    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181846.2-2078s21c1
Sequence:CCGGGTGCCTTGGCACCTACTATTTCTCGAGAAATAGTAGGTGCCAAGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181846.1-664s1c1
Sequence:CCGGGCCTTTGTCAAGGCATGTGAACTCGAGTTCACATGCCTTGACAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181846.1-870s1c1
Sequence:CCGGGCCTCCTTCAGAAGACAAATTCTCGAGAATTTGTCTTCTGAAGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181846.1-744s1c1
Sequence:CCGGCCAACAGATCCACTTCAAGAACTCGAGTTCTTGAAGTGGATCTGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181846.1-1329s1c1
Sequence:CCGGCCTGACTCAACACCAGCGCATCTCGAGATGCGCTGGTGTTGAGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181846.1-262s1c1
Sequence:CCGGCATGACCACATTGCTCACTCTCTCGAGAGAGTGAGCAATGTGGTCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181846
ZSCAN22 MISSION shRNA Lentiviral Transduction Particles
zinc finger and SCAN domain containing 22
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426827    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181846.2-1898s21c1
Sequence:CCGGGCAGCCGAACTGAGGATTTAGCTCGAGCTAAATCCTCAGTTCGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181846.2-605s21c1
Sequence:CCGGGAGAGTCAGAGCCATCAAATGCTCGAGCATTTGATGGCTCTGACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426251    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181846.2-2078s21c1
Sequence:CCGGGTGCCTTGGCACCTACTATTTCTCGAGAAATAGTAGGTGCCAAGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181846.1-664s1c1
Sequence:CCGGGCCTTTGTCAAGGCATGTGAACTCGAGTTCACATGCCTTGACAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181846.1-870s1c1
Sequence:CCGGGCCTCCTTCAGAAGACAAATTCTCGAGAATTTGTCTTCTGAAGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181846.1-744s1c1
Sequence:CCGGCCAACAGATCCACTTCAAGAACTCGAGTTCTTGAAGTGGATCTGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181846.1-1329s1c1
Sequence:CCGGCCTGACTCAACACCAGCGCATCTCGAGATGCGCTGGTGTTGAGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181846.1-262s1c1
Sequence:CCGGCATGACCACATTGCTCACTCTCTCGAGAGAGTGAGCAATGTGGTCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001447
VALIDATED
ZSCAN22 MISSION shRNA Bacterial Glycerol Stock
zinc finger and SCAN domain containing 22
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000367140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001001447.2-1648s21c1
Sequence:CCGGAGCTCTCATGGTGCACCTAAACTCGAGTTTAGGTGCACCATGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001001447.2-731s21c1
Sequence:CCGGACCCTTGCCCACACTTGTAAACTCGAGTTTACAAGTGTGGGCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001447.2-315s21c1
Sequence:CCGGAGGAATCCAGCCCTAGCTTTACTCGAGTAAAGCTAGGGCTGGATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001447
VALIDATED
ZSCAN22 MISSION shRNA shRNA Plasmid DNA
zinc finger and SCAN domain containing 22
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000367140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001001447.2-1648s21c1
Sequence:CCGGAGCTCTCATGGTGCACCTAAACTCGAGTTTAGGTGCACCATGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001001447.2-731s21c1
Sequence:CCGGACCCTTGCCCACACTTGTAAACTCGAGTTTACAAGTGTGGGCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001447.2-315s21c1
Sequence:CCGGAGGAATCCAGCCCTAGCTTTACTCGAGTAAAGCTAGGGCTGGATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001447
VALIDATED
ZSCAN22 MISSION shRNA Lentiviral Transduction Particles
zinc finger and SCAN domain containing 22
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000367140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001001447.2-1648s21c1
Sequence:CCGGAGCTCTCATGGTGCACCTAAACTCGAGTTTAGGTGCACCATGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001001447.2-731s21c1
Sequence:CCGGACCCTTGCCCACACTTGTAAACTCGAGTTTACAAGTGTGGGCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001447.2-315s21c1
Sequence:CCGGAGGAATCCAGCCCTAGCTTTACTCGAGTAAAGCTAGGGCTGGATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_133180
VALIDATED
ZSCAN22 MISSION shRNA Bacterial Glycerol Stock
zinc finger and SCAN domain containing 22
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133180.3-1190s1c1
Sequence:CCGGGCGTGTAAAGAGTGTGGTAAACTCGAGTTTACCACACTCTTTACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: B16-F0
TRC Version: 1 Clone ID:XM_133180.3-693s1c1
Sequence:CCGGCGACTGAAACTGTCATGGGAACTCGAGTTCCCATGACAGTTTCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086643    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:XM_133180.3-2257s1c1
Sequence:CCGGCGCAGGCTCATCTCTAATCTACTCGAGTAGATTAGAGATGAGCCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133180.3-1020s1c1
Sequence:CCGGCCAAGGATAGTGAATGTTTGACTCGAGTCAAACATTCACTATCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:XM_133180.3-950s1c1
Sequence:CCGGGAGGAGAAATTTGGCCCATTACTCGAGTAATGGGCCAAATTTCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_133180
VALIDATED
ZSCAN22 MISSION shRNA shRNA Plasmid DNA
zinc finger and SCAN domain containing 22
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133180.3-1190s1c1
Sequence:CCGGGCGTGTAAAGAGTGTGGTAAACTCGAGTTTACCACACTCTTTACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: B16-F0
TRC Version: 1 Clone ID:XM_133180.3-693s1c1
Sequence:CCGGCGACTGAAACTGTCATGGGAACTCGAGTTCCCATGACAGTTTCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086643    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:XM_133180.3-2257s1c1
Sequence:CCGGCGCAGGCTCATCTCTAATCTACTCGAGTAGATTAGAGATGAGCCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133180.3-1020s1c1
Sequence:CCGGCCAAGGATAGTGAATGTTTGACTCGAGTCAAACATTCACTATCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:XM_133180.3-950s1c1
Sequence:CCGGGAGGAGAAATTTGGCCCATTACTCGAGTAATGGGCCAAATTTCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_133180
VALIDATED
ZSCAN22 MISSION shRNA Lentiviral Transduction Particles
zinc finger and SCAN domain containing 22
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133180.3-1190s1c1
Sequence:CCGGGCGTGTAAAGAGTGTGGTAAACTCGAGTTTACCACACTCTTTACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: B16-F0
TRC Version: 1 Clone ID:XM_133180.3-693s1c1
Sequence:CCGGCGACTGAAACTGTCATGGGAACTCGAGTTCCCATGACAGTTTCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086643    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:XM_133180.3-2257s1c1
Sequence:CCGGCGCAGGCTCATCTCTAATCTACTCGAGTAGATTAGAGATGAGCCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133180.3-1020s1c1
Sequence:CCGGCCAAGGATAGTGAATGTTTGACTCGAGTCAAACATTCACTATCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:XM_133180.3-950s1c1
Sequence:CCGGGAGGAGAAATTTGGCCCATTACTCGAGTAATGGGCCAAATTTCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks