EMAIL THIS PAGE TO A FRIEND

ZSCAN23

zinc finger and SCAN domain containing 23

Synonyms: ZNF390 ZNF453 dJ29K1.3 dJ29K1.3.1
UniProtKB ID: Q3MJ62, Q96KV9
Gene ID:
naked mole-rat(101722305) zinc finger and SCAN domain containing 23
domestic guinea pig(100718172) zinc finger and SCAN domain containing 23
cow(101904212) zinc finger and SCAN domain containing 23
cow(100139972) zinc finger and SCAN domain containing 23
domestic cat(101090356) zinc finger and SCAN domain containing 23
Horse(100061358) zinc finger and SCAN domain containing 23
8 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001012455 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012455 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012455 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012455
ZSCAN23 MISSION shRNA Bacterial Glycerol Stock
zinc finger and SCAN domain containing 23
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012455.1-1291s21c1
Sequence:CCGGCATTTACCATTGCAACCTAATCTCGAGATTAGGTTGCAATGGTAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012455.1-1211s21c1
Sequence:CCGGCGACGTTCAGTCCTCATTAAGCTCGAGCTTAATGAGGACTGAACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247648    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012455.1-1698s21c1
Sequence:CCGGATGCAGTTCACCGAGTATTTACTCGAGTAAATACTCGGTGAACTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012455.1-686s21c1
Sequence:CCGGGAAGAGCAACTTGGGTATAATCTCGAGATTATACCCAAGTTGCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012455.1-911s21c1
Sequence:CCGGTCAGTGGAGAGACCCTATATCCTCGAGGATATAGGGTCTCTCCACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012455
ZSCAN23 MISSION shRNA shRNA Plasmid DNA
zinc finger and SCAN domain containing 23
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012455.1-1291s21c1
Sequence:CCGGCATTTACCATTGCAACCTAATCTCGAGATTAGGTTGCAATGGTAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012455.1-1211s21c1
Sequence:CCGGCGACGTTCAGTCCTCATTAAGCTCGAGCTTAATGAGGACTGAACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247648    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012455.1-1698s21c1
Sequence:CCGGATGCAGTTCACCGAGTATTTACTCGAGTAAATACTCGGTGAACTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012455.1-686s21c1
Sequence:CCGGGAAGAGCAACTTGGGTATAATCTCGAGATTATACCCAAGTTGCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012455.1-911s21c1
Sequence:CCGGTCAGTGGAGAGACCCTATATCCTCGAGGATATAGGGTCTCTCCACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012455
ZSCAN23 MISSION shRNA Lentiviral Transduction Particles
zinc finger and SCAN domain containing 23
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012455.1-1291s21c1
Sequence:CCGGCATTTACCATTGCAACCTAATCTCGAGATTAGGTTGCAATGGTAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012455.1-1211s21c1
Sequence:CCGGCGACGTTCAGTCCTCATTAAGCTCGAGCTTAATGAGGACTGAACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247648    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012455.1-1698s21c1
Sequence:CCGGATGCAGTTCACCGAGTATTTACTCGAGTAAATACTCGGTGAACTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012455.1-686s21c1
Sequence:CCGGGAAGAGCAACTTGGGTATAATCTCGAGATTATACCCAAGTTGCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012455.1-911s21c1
Sequence:CCGGTCAGTGGAGAGACCCTATATCCTCGAGGATATAGGGTCTCTCCACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks