EMAIL THIS PAGE TO A FRIEND

ZSCAN25

zinc finger and SCAN domain containing 25

Synonyms: ZNF498
Species: Human ZSCAN25(221785), Mouse Zscan25(666311), domestic guinea pig Zscan25(100721244), naked mole-rat Zscan25(101702605)
Gene ID:
Human(221785) Summary: This gene encodes a protein that bears some similarity to zinc finger proteins, which are involved in DNA binding and protein-protein interactions. Multiple alternatively spliced transcript variants have been identified, but the full-length nature for most of them has not been determined. [provided by RefSeq, Jul 2008]
Mouse(666311) zinc finger and SCAN domain containing 25
domestic guinea pig(100721244) zinc finger and SCAN domain containing 25
naked mole-rat(101702605) zinc finger and SCAN domain containing 25
129 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145115 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145115 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145115 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081431 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081431 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081431 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145115 Rosetta Predictions human pricing
NM_001081431 Rosetta Predictions mouse pricing
XM_991755 Rosetta Predictions mouse pricing
XM_991782 Rosetta Predictions mouse pricing
XM_991801 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145115 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00071923 predicted 2111
2 SASI_Hs01_00071924 predicted 421
3 SASI_Hs01_00071925 predicted 974
4 SASI_Hs01_00071927 predicted 1566
5 SASI_Hs01_00071928 predicted 1186
6 SASI_Hs01_00071929 predicted 1902
7 SASI_Hs01_00071930 predicted 899
8 SASI_Hs01_00071931 predicted 1385
9 SASI_Hs01_00071932 predicted 2059
10 SASI_Hs02_00364996 predicted 1386
11 SASI_Hs01_00071926 predicted 507
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081431 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298311 predicted 1627
2 SASI_Mm02_00298312 predicted 509
3 SASI_Mm02_00298313 predicted 908
4 SASI_Mm02_00298314 predicted 1197
5 SASI_Mm02_00298315 predicted 1126
6 SASI_Mm02_00298316 predicted 692
7 SASI_Mm02_00298317 predicted 917
8 SASI_Mm02_00298318 predicted 1496
9 SASI_Mm02_00298319 predicted 1244
10 SASI_Mm02_00298320 predicted 1054
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_991755 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00206003 predicted 306
2 SASI_Mm01_00206004 predicted 624
3 SASI_Mm01_00206005 predicted 656
4 SASI_Mm01_00206006 predicted 313
5 SASI_Mm01_00206007 predicted 286
6 SASI_Mm01_00206008 predicted 596
7 SASI_Mm01_00206009 predicted 634
8 SASI_Mm01_00206010 predicted 602
9 SASI_Mm01_00206011 predicted 502
10 SASI_Mm01_00206012 predicted 238
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_991782 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00207199 predicted 748
2 SASI_Mm01_00207200 predicted 1624
3 SASI_Mm01_00207201 predicted 905
4 SASI_Mm01_00207202 predicted 1194
5 SASI_Mm01_00207203 predicted 1125
6 SASI_Mm01_00207204 predicted 915
7 SASI_Mm01_00207205 predicted 1505
8 SASI_Mm01_00207206 predicted 1250
9 SASI_Mm01_00207207 predicted 1061
10 SASI_Mm01_00207208 predicted 929
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_991801 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00284973 predicted 857
2 SASI_Mm01_00284974 predicted 1735
3 SASI_Mm01_00284975 predicted 1022
4 SASI_Mm01_00284976 predicted 1305
5 SASI_Mm01_00284977 predicted 1235
6 SASI_Mm01_00284978 predicted 1034
7 SASI_Mm01_00284979 predicted 301
8 SASI_Mm01_00284980 predicted 1610
9 SASI_Mm01_00284981 predicted 1359
10 SASI_Mm01_00284982 predicted 1168
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145115
VALIDATED
ZSCAN25 MISSION shRNA Bacterial Glycerol Stock
zinc finger and SCAN domain containing 25
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145115.2-362s21c1
Sequence:CCGGCTCAGCAGCAGTTGGGTATTCCTCGAGGAATACCCAACTGCTGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145115.2-1197s21c1
Sequence:CCGGACTGACATCAGAGAGGTTTGGCTCGAGCCAAACCTCTCTGATGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_145115.2-974s21c1
Sequence:CCGGAGATGGCAGCTGGGTTCTTTACTCGAGTAAAGAACCCAGCTGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145115.2-1432s21c1
Sequence:CCGGACCCACGAAGAGAAGTCTTATCTCGAGATAAGACTTCTCTTCGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244963    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145115.2-2851s21c1
Sequence:CCGGCTAGTATTAATGCCCTATATTCTCGAGAATATAGGGCATTAATACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107690    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145115.2-3629s1c1
Sequence:CCGGGCCCACTTTGAAACGTGGTTTCTCGAGAAACCACGTTTCAAAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145115.2-1482s1c1
Sequence:CCGGCCTGAGAGAATACCTGATGAACTCGAGTTCATCAGGTATTCTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145115.2-372s1c1
Sequence:CCGGGTTGGGTATTCCTGTGGTGAACTCGAGTTCACCACAGGAATACCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_145115.2-1430s1c1
Sequence:CCGGGAACCCACGAAGAGAAGTCTTCTCGAGAAGACTTCTCTTCGTGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145115.2-1072s1c1
Sequence:CCGGCCAGCCCAGATAGACTGCTTTCTCGAGAAAGCAGTCTATCTGGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145115
VALIDATED
ZSCAN25 MISSION shRNA shRNA Plasmid DNA
zinc finger and SCAN domain containing 25
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145115.2-362s21c1
Sequence:CCGGCTCAGCAGCAGTTGGGTATTCCTCGAGGAATACCCAACTGCTGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145115.2-1197s21c1
Sequence:CCGGACTGACATCAGAGAGGTTTGGCTCGAGCCAAACCTCTCTGATGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_145115.2-974s21c1
Sequence:CCGGAGATGGCAGCTGGGTTCTTTACTCGAGTAAAGAACCCAGCTGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145115.2-1432s21c1
Sequence:CCGGACCCACGAAGAGAAGTCTTATCTCGAGATAAGACTTCTCTTCGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244963    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145115.2-2851s21c1
Sequence:CCGGCTAGTATTAATGCCCTATATTCTCGAGAATATAGGGCATTAATACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107690    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145115.2-3629s1c1
Sequence:CCGGGCCCACTTTGAAACGTGGTTTCTCGAGAAACCACGTTTCAAAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145115.2-1482s1c1
Sequence:CCGGCCTGAGAGAATACCTGATGAACTCGAGTTCATCAGGTATTCTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145115.2-372s1c1
Sequence:CCGGGTTGGGTATTCCTGTGGTGAACTCGAGTTCACCACAGGAATACCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_145115.2-1430s1c1
Sequence:CCGGGAACCCACGAAGAGAAGTCTTCTCGAGAAGACTTCTCTTCGTGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145115.2-1072s1c1
Sequence:CCGGCCAGCCCAGATAGACTGCTTTCTCGAGAAAGCAGTCTATCTGGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145115
VALIDATED
ZSCAN25 MISSION shRNA Lentiviral Transduction Particles
zinc finger and SCAN domain containing 25
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145115.2-362s21c1
Sequence:CCGGCTCAGCAGCAGTTGGGTATTCCTCGAGGAATACCCAACTGCTGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145115.2-1197s21c1
Sequence:CCGGACTGACATCAGAGAGGTTTGGCTCGAGCCAAACCTCTCTGATGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_145115.2-974s21c1
Sequence:CCGGAGATGGCAGCTGGGTTCTTTACTCGAGTAAAGAACCCAGCTGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145115.2-1432s21c1
Sequence:CCGGACCCACGAAGAGAAGTCTTATCTCGAGATAAGACTTCTCTTCGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244963    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145115.2-2851s21c1
Sequence:CCGGCTAGTATTAATGCCCTATATTCTCGAGAATATAGGGCATTAATACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107690    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145115.2-3629s1c1
Sequence:CCGGGCCCACTTTGAAACGTGGTTTCTCGAGAAACCACGTTTCAAAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145115.2-1482s1c1
Sequence:CCGGCCTGAGAGAATACCTGATGAACTCGAGTTCATCAGGTATTCTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145115.2-372s1c1
Sequence:CCGGGTTGGGTATTCCTGTGGTGAACTCGAGTTCACCACAGGAATACCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_145115.2-1430s1c1
Sequence:CCGGGAACCCACGAAGAGAAGTCTTCTCGAGAAGACTTCTCTTCGTGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145115.2-1072s1c1
Sequence:CCGGCCAGCCCAGATAGACTGCTTTCTCGAGAAAGCAGTCTATCTGGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081431
VALIDATED
ZSCAN25 MISSION shRNA Bacterial Glycerol Stock
zinc finger and SCAN domain containing 25
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000240269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081431.1-1056s21c1
Sequence:CCGGCACCCTCAACACCCACAATTCCTCGAGGAATTGTGGGTGTTGAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240271    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081431.1-1761s21c1
Sequence:CCGGGACAGCAGAACGTGCTCAAGTCTCGAGACTTGAGCACGTTCTGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081431.1-941s21c1
Sequence:CCGGGAGAAGCCGACATCCAGATTCCTCGAGGAATCTGGATGTCGGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081431.1-1122s21c1
Sequence:CCGGTCGGAGCTCCAACCTTGTTAGCTCGAGCTAACAAGGTTGGAGCTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081431
VALIDATED
ZSCAN25 MISSION shRNA shRNA Plasmid DNA
zinc finger and SCAN domain containing 25
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000240269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081431.1-1056s21c1
Sequence:CCGGCACCCTCAACACCCACAATTCCTCGAGGAATTGTGGGTGTTGAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240271    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081431.1-1761s21c1
Sequence:CCGGGACAGCAGAACGTGCTCAAGTCTCGAGACTTGAGCACGTTCTGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081431.1-941s21c1
Sequence:CCGGGAGAAGCCGACATCCAGATTCCTCGAGGAATCTGGATGTCGGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081431.1-1122s21c1
Sequence:CCGGTCGGAGCTCCAACCTTGTTAGCTCGAGCTAACAAGGTTGGAGCTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081431
VALIDATED
ZSCAN25 MISSION shRNA Lentiviral Transduction Particles
zinc finger and SCAN domain containing 25
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000240269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081431.1-1056s21c1
Sequence:CCGGCACCCTCAACACCCACAATTCCTCGAGGAATTGTGGGTGTTGAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240271    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081431.1-1761s21c1
Sequence:CCGGGACAGCAGAACGTGCTCAAGTCTCGAGACTTGAGCACGTTCTGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081431.1-941s21c1
Sequence:CCGGGAGAAGCCGACATCCAGATTCCTCGAGGAATCTGGATGTCGGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081431.1-1122s21c1
Sequence:CCGGTCGGAGCTCCAACCTTGTTAGCTCGAGCTAACAAGGTTGGAGCTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks