EMAIL THIS PAGE TO A FRIEND

ZSCAN26

zinc finger and SCAN domain containing 26

Synonyms: SRE-ZBP ZNF187
UniProtKB ID: Q16670, Q5JPG4, Q7Z3Q6, Q96A17
Gene ID:
Mouse(432731) zinc finger and SCAN domain containing 26
naked mole-rat(101696724) zinc finger and SCAN domain containing 26
domestic guinea pig(101787630) zinc finger and SCAN domain containing 26
cow(512445) zinc finger protein 187
101 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013786 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001013786 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001013786 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152736 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152736 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152736 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU084761 MISSION® esiRNA esiRNA human ZNF187 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001023560 Rosetta Predictions human pricing
NM_001111039 Rosetta Predictions human pricing
NM_007151 Rosetta Predictions human pricing
NM_152736 Rosetta Predictions human pricing
NM_001013786 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001023560 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040199 predicted 949
2 SASI_Hs01_00040200 predicted 907
3 SASI_Hs01_00040201 predicted 1031
4 SASI_Hs01_00040202 predicted 1680
5 SASI_Hs01_00040203 predicted 938
6 SASI_Hs01_00040204 predicted 1006
7 SASI_Hs01_00040205 predicted 956
8 SASI_Hs01_00040206 predicted 940
9 SASI_Hs01_00040208 predicted 1149
10 SASI_Hs02_00307080 predicted 1424
11 SASI_Hs01_00040207 predicted 1080
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111039 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325166 predicted 941
2 SASI_Hs02_00325167 predicted 910
3 SASI_Hs02_00325168 predicted 1036
4 SASI_Hs02_00325169 predicted 1673
5 SASI_Hs02_00325170 predicted 939
6 SASI_Hs02_00325171 predicted 998
7 SASI_Hs02_00325172 predicted 953
8 SASI_Hs02_00325173 predicted 941
9 SASI_Hs02_00325174 predicted 1146
10 SASI_Hs02_00325175 predicted 1422
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007151 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141802 predicted 1177
2 SASI_Hs01_00141803 predicted 1142
3 SASI_Hs01_00141804 predicted 1263
4 SASI_Hs01_00141805 predicted 1910
5 SASI_Hs01_00141806 predicted 1171
6 SASI_Hs01_00141807 predicted 1236
7 SASI_Hs01_00141808 predicted 1191
8 SASI_Hs01_00141809 predicted 1166
9 SASI_Hs01_00141810 predicted 1410
10 SASI_Hs01_00141811 predicted 1374
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152736 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201907 predicted 543
2 SASI_Hs01_00201908 predicted 508
3 SASI_Hs01_00201909 predicted 634
4 SASI_Hs01_00201910 predicted 1267
5 SASI_Hs01_00201911 predicted 537
6 SASI_Hs01_00201912 predicted 603
7 SASI_Hs01_00201913 predicted 549
8 SASI_Hs01_00201914 predicted 537
9 SASI_Hs01_00201916 predicted 739
10 SASI_Hs02_00366653 predicted 1023
11 SASI_Hs01_00201915 predicted 674
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013786 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00287347 predicted 516
2 SASI_Mm02_00287348 predicted 1241
3 SASI_Mm02_00287349 predicted 573
4 SASI_Mm02_00287350 predicted 510
5 SASI_Mm02_00287351 predicted 1249
6 SASI_Mm02_00287352 predicted 362
7 SASI_Mm02_00287353 predicted 1082
8 SASI_Mm02_00287354 predicted 1095
9 SASI_Mm02_00287355 predicted 1196
10 SASI_Mm02_00287356 predicted 1068
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013786
ZSCAN26 MISSION shRNA Bacterial Glycerol Stock
zinc finger and SCAN domain containing 26
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096149    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013786.1-3186s1c1
Sequence:CCGGGCCCACACTTTGCATGTGATACTCGAGTATCACATGCAAAGTGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013786.1-841s1c1
Sequence:CCGGCCGACCTTATTCGACATCATACTCGAGTATGATGTCGAATAAGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013786.1-435s1c1
Sequence:CCGGGACCATCAGGAAATCTCTAAACTCGAGTTTAGAGATTTCCTGATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013786.1-999s1c1
Sequence:CCGGAGGCAGAAGTCTGGTCTCTTTCTCGAGAAAGAGACCAGACTTCTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013786.1-915s1c1
Sequence:CCGGCGCCTAAATTCACACTTAGATCTCGAGATCTAAGTGTGAATTTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013786
ZSCAN26 MISSION shRNA shRNA Plasmid DNA
zinc finger and SCAN domain containing 26
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096149    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013786.1-3186s1c1
Sequence:CCGGGCCCACACTTTGCATGTGATACTCGAGTATCACATGCAAAGTGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013786.1-841s1c1
Sequence:CCGGCCGACCTTATTCGACATCATACTCGAGTATGATGTCGAATAAGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013786.1-435s1c1
Sequence:CCGGGACCATCAGGAAATCTCTAAACTCGAGTTTAGAGATTTCCTGATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013786.1-999s1c1
Sequence:CCGGAGGCAGAAGTCTGGTCTCTTTCTCGAGAAAGAGACCAGACTTCTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013786.1-915s1c1
Sequence:CCGGCGCCTAAATTCACACTTAGATCTCGAGATCTAAGTGTGAATTTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013786
ZSCAN26 MISSION shRNA Lentiviral Transduction Particles
zinc finger and SCAN domain containing 26
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096149    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013786.1-3186s1c1
Sequence:CCGGGCCCACACTTTGCATGTGATACTCGAGTATCACATGCAAAGTGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013786.1-841s1c1
Sequence:CCGGCCGACCTTATTCGACATCATACTCGAGTATGATGTCGAATAAGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013786.1-435s1c1
Sequence:CCGGGACCATCAGGAAATCTCTAAACTCGAGTTTAGAGATTTCCTGATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013786.1-999s1c1
Sequence:CCGGAGGCAGAAGTCTGGTCTCTTTCTCGAGAAAGAGACCAGACTTCTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013786.1-915s1c1
Sequence:CCGGCGCCTAAATTCACACTTAGATCTCGAGATCTAAGTGTGAATTTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152736
VALIDATED
ZSCAN26 MISSION shRNA Bacterial Glycerol Stock
zinc finger and SCAN domain containing 26
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013003    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_152736.2-1495s1c1
Sequence:CCGGCCCACAGATTTGCAGGCTTAACTCGAGTTAAGCCTGCAAATCTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152736.2-1038s1c1
Sequence:CCGGTCAGCATGTAAGAATCCACAACTCGAGTTGTGGATTCTTACATGCTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_152736.2-222s1c1
Sequence:CCGGGCATGAGTGTGAAGTTACAAACTCGAGTTTGTAACTTCACACTCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_152736.2-435s1c1
Sequence:CCGGGCAGAGATTCATCCAGCACTTCTCGAGAAGTGCTGGATGAATCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_152736.2-397s1c1
Sequence:CCGGCCCAAAGAGAAGATTGAGTATCTCGAGATACTCAATCTTCTCTTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152736.4-487s21c1
Sequence:CCGGGAACCCATGGAGGCTCATAATCTCGAGATTATGAGCCTCCATGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152736.4-542s21c1
Sequence:CCGGCCAAAGAGAAGATTGAGTATACTCGAGTATACTCAATCTTCTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219040    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_152736.4-1494s21c1
Sequence:GTACCGGGATGATATGCTAGGATCAAAGCTCGAGCTTTGATCCTAGCATATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152736.4-1079s21c1
Sequence:CCGGGTTTGACCTCAGACCTTATTCCTCGAGGAATAAGGTCTGAGGTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152736.4-910s21c1
Sequence:CCGGAGGCGCAGCTCTCACCTTAATCTCGAGATTAAGGTGAGAGCTGCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152736
VALIDATED
ZSCAN26 MISSION shRNA shRNA Plasmid DNA
zinc finger and SCAN domain containing 26
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013003    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_152736.2-1495s1c1
Sequence:CCGGCCCACAGATTTGCAGGCTTAACTCGAGTTAAGCCTGCAAATCTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152736.2-1038s1c1
Sequence:CCGGTCAGCATGTAAGAATCCACAACTCGAGTTGTGGATTCTTACATGCTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_152736.2-222s1c1
Sequence:CCGGGCATGAGTGTGAAGTTACAAACTCGAGTTTGTAACTTCACACTCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_152736.2-435s1c1
Sequence:CCGGGCAGAGATTCATCCAGCACTTCTCGAGAAGTGCTGGATGAATCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_152736.2-397s1c1
Sequence:CCGGCCCAAAGAGAAGATTGAGTATCTCGAGATACTCAATCTTCTCTTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152736.4-487s21c1
Sequence:CCGGGAACCCATGGAGGCTCATAATCTCGAGATTATGAGCCTCCATGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152736.4-542s21c1
Sequence:CCGGCCAAAGAGAAGATTGAGTATACTCGAGTATACTCAATCTTCTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219040    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_152736.4-1494s21c1
Sequence:GTACCGGGATGATATGCTAGGATCAAAGCTCGAGCTTTGATCCTAGCATATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152736.4-1079s21c1
Sequence:CCGGGTTTGACCTCAGACCTTATTCCTCGAGGAATAAGGTCTGAGGTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152736.4-910s21c1
Sequence:CCGGAGGCGCAGCTCTCACCTTAATCTCGAGATTAAGGTGAGAGCTGCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152736
VALIDATED
ZSCAN26 MISSION shRNA Lentiviral Transduction Particles
zinc finger and SCAN domain containing 26
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013003    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_152736.2-1495s1c1
Sequence:CCGGCCCACAGATTTGCAGGCTTAACTCGAGTTAAGCCTGCAAATCTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152736.2-1038s1c1
Sequence:CCGGTCAGCATGTAAGAATCCACAACTCGAGTTGTGGATTCTTACATGCTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_152736.2-222s1c1
Sequence:CCGGGCATGAGTGTGAAGTTACAAACTCGAGTTTGTAACTTCACACTCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_152736.2-435s1c1
Sequence:CCGGGCAGAGATTCATCCAGCACTTCTCGAGAAGTGCTGGATGAATCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_152736.2-397s1c1
Sequence:CCGGCCCAAAGAGAAGATTGAGTATCTCGAGATACTCAATCTTCTCTTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152736.4-487s21c1
Sequence:CCGGGAACCCATGGAGGCTCATAATCTCGAGATTATGAGCCTCCATGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152736.4-542s21c1
Sequence:CCGGCCAAAGAGAAGATTGAGTATACTCGAGTATACTCAATCTTCTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219040    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_152736.4-1494s21c1
Sequence:GTACCGGGATGATATGCTAGGATCAAAGCTCGAGCTTTGATCCTAGCATATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152736.4-1079s21c1
Sequence:CCGGGTTTGACCTCAGACCTTATTCCTCGAGGAATAAGGTCTGAGGTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152736.4-910s21c1
Sequence:CCGGAGGCGCAGCTCTCACCTTAATCTCGAGATTAAGGTGAGAGCTGCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks