EMAIL THIS PAGE TO A FRIEND

ZSCAN29

zinc finger and SCAN domain containing 29

Synonyms: ZNF690 Zfp690
UniProtKB ID: Q8IWY8, B3KVB9, Q32M75, Q32M76, Q8NA40
Gene ID:
Mouse(99334) zinc finger SCAN domains 29
domestic cat(101099381) zinc finger and SCAN domain containing 29
Horse(100056404) zinc finger and SCAN domain containing 29
dog(478272) zinc finger and SCAN domain containing 29
cow(512668) zinc finger and SCAN domain containing 29
sheep(101107139) zinc finger and SCAN domain containing 29
domestic guinea pig(100717023) zinc finger and SCAN domain containing 29
naked mole-rat(101720736) zinc finger and SCAN domain containing 29
Domestic Rabbit(100328678) zinc finger and SCAN domain containing 29
190 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178889 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178889 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178889 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152455 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152455 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152455 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152455 Rosetta Predictions human pricing
XM_001480554 Rosetta Predictions mouse pricing
XM_001480624 Rosetta Predictions mouse pricing
XM_619803 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152455 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366228 predicted 2772
2 SASI_Hs02_00366229 predicted 2762
3 SASI_Hs01_00036936 predicted 2094
4 SASI_Hs01_00036938 predicted 1127
5 SASI_Hs01_00036939 predicted 1963
6 SASI_Hs01_00036941 predicted 1898
7 SASI_Hs01_00036943 predicted 729
8 SASI_Hs01_00036945 predicted 1485
9 SASI_Hs02_00366230 predicted 1326
10 SASI_Hs02_00366231 predicted 2555
11 SASI_Hs01_00036937 predicted 508
12 SASI_Hs01_00036940 predicted 1001
13 SASI_Hs01_00036942 predicted 1798
14 SASI_Hs01_00036944 predicted 2028
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001480554 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00418335 predicted 2453
2 SASI_Mm02_00418336 predicted 2926
3 SASI_Mm02_00418337 predicted 2794
4 SASI_Mm02_00418338 predicted 3558
5 SASI_Mm02_00418339 predicted 1528
6 SASI_Mm02_00418340 predicted 1757
7 SASI_Mm02_00418341 predicted 2584
8 SASI_Mm02_00418342 predicted 2852
9 SASI_Mm02_00418343 predicted 1359
10 SASI_Mm02_00418344 predicted 2342
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001480624 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00418846 predicted 2454
2 SASI_Mm02_00418847 predicted 2924
3 SASI_Mm02_00418848 predicted 2798
4 SASI_Mm02_00418849 predicted 3556
5 SASI_Mm02_00418850 predicted 1533
6 SASI_Mm02_00418851 predicted 1759
7 SASI_Mm02_00418852 predicted 2579
8 SASI_Mm02_00418853 predicted 2845
9 SASI_Mm02_00418854 predicted 2740
10 SASI_Mm02_00418855 predicted 1356
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_619803 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00229205 predicted 2903
2 SASI_Mm01_00229206 predicted 3037
3 SASI_Mm01_00229207 predicted 2912
4 SASI_Mm01_00229208 predicted 1540
5 SASI_Mm01_00229209 predicted 1760
6 SASI_Mm01_00229210 predicted 2958
7 SASI_Mm01_00229211 predicted 3175
8 SASI_Mm01_00229212 predicted 1388
9 SASI_Mm01_00229213 predicted 2011
10 SASI_Mm01_00229214 predicted 2457
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178889
ZSCAN29 MISSION shRNA Bacterial Glycerol Stock
zinc finger and SCAN domain containing 29
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178889.3-1850s21c1
Sequence:CCGGAGCTGGGAGGCTTCGTGAATACTCGAGTATTCACGAAGCCTCCCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085028    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178889.2-2224s1c1
Sequence:CCGGCCCTTGAGCTACACCTCAAATCTCGAGATTTGAGGTGTAGCTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178889.2-1422s1c1
Sequence:CCGGCAGGAACCAGTCTATTACCATCTCGAGATGGTAATAGACTGGTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178889.2-1774s1c1
Sequence:CCGGCCAGGTCATTTCATTGCCCATCTCGAGATGGGCAATGAAATGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178889.2-1739s1c1
Sequence:CCGGCCCTTCTTTGAAGAGATGGAACTCGAGTTCCATCTCTTCAAAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178889.2-1776s1c1
Sequence:CCGGAGGTCATTTCATTGCCCATTACTCGAGTAATGGGCAATGAAATGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178889
ZSCAN29 MISSION shRNA shRNA Plasmid DNA
zinc finger and SCAN domain containing 29
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178889.3-1850s21c1
Sequence:CCGGAGCTGGGAGGCTTCGTGAATACTCGAGTATTCACGAAGCCTCCCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085028    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178889.2-2224s1c1
Sequence:CCGGCCCTTGAGCTACACCTCAAATCTCGAGATTTGAGGTGTAGCTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178889.2-1422s1c1
Sequence:CCGGCAGGAACCAGTCTATTACCATCTCGAGATGGTAATAGACTGGTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178889.2-1774s1c1
Sequence:CCGGCCAGGTCATTTCATTGCCCATCTCGAGATGGGCAATGAAATGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178889.2-1739s1c1
Sequence:CCGGCCCTTCTTTGAAGAGATGGAACTCGAGTTCCATCTCTTCAAAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178889.2-1776s1c1
Sequence:CCGGAGGTCATTTCATTGCCCATTACTCGAGTAATGGGCAATGAAATGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178889
ZSCAN29 MISSION shRNA Lentiviral Transduction Particles
zinc finger and SCAN domain containing 29
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178889.3-1850s21c1
Sequence:CCGGAGCTGGGAGGCTTCGTGAATACTCGAGTATTCACGAAGCCTCCCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085028    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178889.2-2224s1c1
Sequence:CCGGCCCTTGAGCTACACCTCAAATCTCGAGATTTGAGGTGTAGCTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178889.2-1422s1c1
Sequence:CCGGCAGGAACCAGTCTATTACCATCTCGAGATGGTAATAGACTGGTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178889.2-1774s1c1
Sequence:CCGGCCAGGTCATTTCATTGCCCATCTCGAGATGGGCAATGAAATGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178889.2-1739s1c1
Sequence:CCGGCCCTTCTTTGAAGAGATGGAACTCGAGTTCCATCTCTTCAAAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178889.2-1776s1c1
Sequence:CCGGAGGTCATTTCATTGCCCATTACTCGAGTAATGGGCAATGAAATGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152455
VALIDATED
ZSCAN29 MISSION shRNA Bacterial Glycerol Stock
zinc finger and SCAN domain containing 29
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000235056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_152455.3-904s21c1
Sequence:CCGGACCAGAACGCTCCTCGCAATTCTCGAGAATTGCGAGGAGCGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_152455.3-2210s21c1
Sequence:CCGGGTCGGAGTGCACGACTCATTACTCGAGTAATGAGTCGTGCACTCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235060    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152455.3-4112s21c1
Sequence:CCGGCAATAGGAACTCGTCCATATTCTCGAGAATATGGACGAGTTCCTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_152455.3-2643s21c1
Sequence:CCGGCCTTAATAAGCACGGAGAAATCTCGAGATTTCTCCGTGCTTATTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_152455.3-1476s21c1
Sequence:CCGGAGCAGTGGCTGAGAGGTTATGCTCGAGCATAACCTCTCAGCCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152455.2-1792s1c1
Sequence:CCGGCGGTATCTTCATCAGGGTAAACTCGAGTTTACCCTGATGAAGATACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_152455.2-1333s1c1
Sequence:CCGGGCTGAGAGGTTATGGGAATATCTCGAGATATTCCCATAACCTCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152455.2-1814s1c1
Sequence:CCGGGCAATGAGAGTGACTGTAGATCTCGAGATCTACAGTCACTCTCATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152455.2-813s1c1
Sequence:CCGGCCATAGGAACAGCCAAGTGTACTCGAGTACACTTGGCTGTTCCTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_152455.2-1696s1c1
Sequence:CCGGGCTGGATTTGAGAATGAAGATCTCGAGATCTTCATTCTCAAATCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152455
VALIDATED
ZSCAN29 MISSION shRNA shRNA Plasmid DNA
zinc finger and SCAN domain containing 29
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000235056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_152455.3-904s21c1
Sequence:CCGGACCAGAACGCTCCTCGCAATTCTCGAGAATTGCGAGGAGCGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_152455.3-2210s21c1
Sequence:CCGGGTCGGAGTGCACGACTCATTACTCGAGTAATGAGTCGTGCACTCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235060    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152455.3-4112s21c1
Sequence:CCGGCAATAGGAACTCGTCCATATTCTCGAGAATATGGACGAGTTCCTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_152455.3-2643s21c1
Sequence:CCGGCCTTAATAAGCACGGAGAAATCTCGAGATTTCTCCGTGCTTATTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_152455.3-1476s21c1
Sequence:CCGGAGCAGTGGCTGAGAGGTTATGCTCGAGCATAACCTCTCAGCCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152455.2-1792s1c1
Sequence:CCGGCGGTATCTTCATCAGGGTAAACTCGAGTTTACCCTGATGAAGATACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_152455.2-1333s1c1
Sequence:CCGGGCTGAGAGGTTATGGGAATATCTCGAGATATTCCCATAACCTCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152455.2-1814s1c1
Sequence:CCGGGCAATGAGAGTGACTGTAGATCTCGAGATCTACAGTCACTCTCATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152455.2-813s1c1
Sequence:CCGGCCATAGGAACAGCCAAGTGTACTCGAGTACACTTGGCTGTTCCTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_152455.2-1696s1c1
Sequence:CCGGGCTGGATTTGAGAATGAAGATCTCGAGATCTTCATTCTCAAATCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152455
VALIDATED
ZSCAN29 MISSION shRNA Lentiviral Transduction Particles
zinc finger and SCAN domain containing 29
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000235056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_152455.3-904s21c1
Sequence:CCGGACCAGAACGCTCCTCGCAATTCTCGAGAATTGCGAGGAGCGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_152455.3-2210s21c1
Sequence:CCGGGTCGGAGTGCACGACTCATTACTCGAGTAATGAGTCGTGCACTCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235060    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152455.3-4112s21c1
Sequence:CCGGCAATAGGAACTCGTCCATATTCTCGAGAATATGGACGAGTTCCTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_152455.3-2643s21c1
Sequence:CCGGCCTTAATAAGCACGGAGAAATCTCGAGATTTCTCCGTGCTTATTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_152455.3-1476s21c1
Sequence:CCGGAGCAGTGGCTGAGAGGTTATGCTCGAGCATAACCTCTCAGCCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152455.2-1792s1c1
Sequence:CCGGCGGTATCTTCATCAGGGTAAACTCGAGTTTACCCTGATGAAGATACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_152455.2-1333s1c1
Sequence:CCGGGCTGAGAGGTTATGGGAATATCTCGAGATATTCCCATAACCTCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152455.2-1814s1c1
Sequence:CCGGGCAATGAGAGTGACTGTAGATCTCGAGATCTACAGTCACTCTCATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152455.2-813s1c1
Sequence:CCGGCCATAGGAACAGCCAAGTGTACTCGAGTACACTTGGCTGTTCCTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_152455.2-1696s1c1
Sequence:CCGGGCTGGATTTGAGAATGAAGATCTCGAGATCTTCATTCTCAAATCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks