EMAIL THIS PAGE TO A FRIEND

ZSCAN2

zinc finger and SCAN domain containing 2

Synonyms: ZFP29 ZNF854
UniProtKB ID: Q7Z7L9, A6NG83, B2RMQ9, Q6ZQY9, Q9NWU4
Gene ID:
Human(54993) Summary: The protein encoded by this gene contains several copies of zinc finger motif, which is commonly found in transcriptional regulatory proteins. Studies in mice show that this gene is expressed during embryonic development, and specifically in the testis in adult mice, suggesting that it may play a role in regulating genes in germ cells. Alternative splicing of this gene results in several transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(22691) zinc finger and SCAN domain containing 2
Rat(683603) zinc finger and SCAN domain containing 2
naked mole-rat(101722217) zinc finger and SCAN domain containing 2
domestic guinea pig(100732043) zinc finger and SCAN domain containing 2
cow(539320) zinc finger and SCAN domain containing 2
sheep(101108082) zinc finger and SCAN domain containing 2
dog(488749) zinc finger and SCAN domain containing 2
Horse(100068631) zinc finger and SCAN domain containing 2
103 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017894 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017894 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017894 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009553 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009553 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009553 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU125391 MISSION® esiRNA esiRNA human ZSCAN2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007072 Rosetta Predictions human pricing
NM_017894 Rosetta Predictions human pricing
NM_181877 Rosetta Predictions human pricing
XM_001066711 Rosetta Predictions rat pricing
NM_009553 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007072 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087020 predicted 272
2 SASI_Hs01_00087022 predicted 297
3 SASI_Hs01_00087024 predicted 260
4 SASI_Hs01_00087025 predicted 366
5 SASI_Hs01_00087027 predicted 330
6 SASI_Hs01_00087028 predicted 330
7 SASI_Hs01_00087023 predicted 259
8 SASI_Hs01_00087026 predicted 231
9 SASI_Hs02_00305210 predicted 317
10 SASI_Hs01_00087029 predicted 787
11 SASI_Hs01_00087021 predicted 276
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017894 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235256 predicted 275
2 SASI_Hs01_00235258 predicted 304
3 SASI_Hs01_00235260 predicted 265
4 SASI_Hs01_00235261 predicted 364
5 SASI_Hs01_00235263 predicted 335
6 SASI_Hs01_00235264 predicted 330
7 SASI_Hs01_00235259 predicted 261
8 SASI_Hs01_00235262 predicted 230
9 SASI_Hs02_00350865 predicted 315
10 SASI_Hs01_00235265 predicted 868
11 SASI_Hs01_00235257 predicted 285
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181877 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023230 predicted 270
2 SASI_Hs01_00023232 predicted 299
3 SASI_Hs01_00023234 predicted 266
4 SASI_Hs01_00023235 predicted 358
5 SASI_Hs01_00023237 predicted 337
6 SASI_Hs01_00023238 predicted 326
7 SASI_Hs01_00023233 predicted 258
8 SASI_Hs01_00023236 predicted 238
9 SASI_Hs02_00370470 predicted 311
10 SASI_Hs01_00023239 predicted 1508
11 SASI_Hs01_00023231 predicted 277
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066711 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00318523 predicted 831
2 SASI_Rn02_00318524 predicted 1264
3 SASI_Rn02_00318525 predicted 1428
4 SASI_Rn02_00318526 predicted 282
5 SASI_Rn02_00318527 predicted 1215
6 SASI_Rn02_00318528 predicted 668
7 SASI_Rn02_00318529 predicted 1335
8 SASI_Rn02_00318530 predicted 991
9 SASI_Rn02_00318531 predicted 1310
10 SASI_Rn02_00318532 predicted 1319
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009553 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00093323 predicted 1099
2 SASI_Mm01_00093324 predicted 340
3 SASI_Mm01_00093325 predicted 768
4 SASI_Mm01_00093326 predicted 908
5 SASI_Mm01_00093327 predicted 1883
6 SASI_Mm01_00093328 predicted 1083
7 SASI_Mm01_00093329 predicted 1154
8 SASI_Mm01_00093331 predicted 1170
9 SASI_Mm01_00093332 predicted 1319
10 SASI_Mm02_00316399 predicted 574
11 SASI_Mm01_00093330 predicted 1076
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017894
VALIDATED
ZSCAN2 MISSION shRNA Bacterial Glycerol Stock
zinc finger and SCAN domain containing 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017894.2-630s1c1
Sequence:CCGGGTGCTGTAGCTGTCTTTGCTTCTCGAGAAGCAAAGACAGCTACAGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017894.2-517s1c1
Sequence:CCGGGATGTTAACCATGCTGCCAAACTCGAGTTTGGCAGCATGGTTAACATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017894.2-482s1c1
Sequence:CCGGCGCTGGCTGAGACCAGAGGTACTCGAGTACCTCTGGTCTCAGCCAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017894.2-531s1c1
Sequence:CCGGTGCCAAAGGAAATTCAGGCTTCTCGAGAAGCCTGAATTTCCTTTGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017894.2-279s1c1
Sequence:CCGGAGGTGCCTCAAGAGGAAGATACTCGAGTATCTTCCTCTTGAGGCACCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017894.4-505s21c1
Sequence:CCGGCACCAAGGAGCAGATGTTAACCTCGAGGTTAACATCTGCTCCTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017894.4-660s21c1
Sequence:CCGGTGGAGGTGACCAGTTTGTAATCTCGAGATTACAAACTGGTCACCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234687    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017894.4-737s21c1
Sequence:CCGGAGAGGCCTCAGGTTGTTATTTCTCGAGAAATAACAACCTGAGGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017894.4-627s21c1
Sequence:CCGGACAGTGCTGTAGCTGTCTTTGCTCGAGCAAAGACAGCTACAGCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017894.4-335s21c1
Sequence:CCGGGATGACTCCTGGGTGCAAGAACTCGAGTTCTTGCACCCAGGAGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017894
VALIDATED
ZSCAN2 MISSION shRNA shRNA Plasmid DNA
zinc finger and SCAN domain containing 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017894.2-630s1c1
Sequence:CCGGGTGCTGTAGCTGTCTTTGCTTCTCGAGAAGCAAAGACAGCTACAGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017894.2-517s1c1
Sequence:CCGGGATGTTAACCATGCTGCCAAACTCGAGTTTGGCAGCATGGTTAACATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017894.2-482s1c1
Sequence:CCGGCGCTGGCTGAGACCAGAGGTACTCGAGTACCTCTGGTCTCAGCCAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017894.2-531s1c1
Sequence:CCGGTGCCAAAGGAAATTCAGGCTTCTCGAGAAGCCTGAATTTCCTTTGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017894.2-279s1c1
Sequence:CCGGAGGTGCCTCAAGAGGAAGATACTCGAGTATCTTCCTCTTGAGGCACCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017894.4-505s21c1
Sequence:CCGGCACCAAGGAGCAGATGTTAACCTCGAGGTTAACATCTGCTCCTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017894.4-660s21c1
Sequence:CCGGTGGAGGTGACCAGTTTGTAATCTCGAGATTACAAACTGGTCACCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234687    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017894.4-737s21c1
Sequence:CCGGAGAGGCCTCAGGTTGTTATTTCTCGAGAAATAACAACCTGAGGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017894.4-627s21c1
Sequence:CCGGACAGTGCTGTAGCTGTCTTTGCTCGAGCAAAGACAGCTACAGCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017894.4-335s21c1
Sequence:CCGGGATGACTCCTGGGTGCAAGAACTCGAGTTCTTGCACCCAGGAGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017894
VALIDATED
ZSCAN2 MISSION shRNA Lentiviral Transduction Particles
zinc finger and SCAN domain containing 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017894.2-630s1c1
Sequence:CCGGGTGCTGTAGCTGTCTTTGCTTCTCGAGAAGCAAAGACAGCTACAGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017894.2-517s1c1
Sequence:CCGGGATGTTAACCATGCTGCCAAACTCGAGTTTGGCAGCATGGTTAACATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017894.2-482s1c1
Sequence:CCGGCGCTGGCTGAGACCAGAGGTACTCGAGTACCTCTGGTCTCAGCCAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017894.2-531s1c1
Sequence:CCGGTGCCAAAGGAAATTCAGGCTTCTCGAGAAGCCTGAATTTCCTTTGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017894.2-279s1c1
Sequence:CCGGAGGTGCCTCAAGAGGAAGATACTCGAGTATCTTCCTCTTGAGGCACCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017894.4-505s21c1
Sequence:CCGGCACCAAGGAGCAGATGTTAACCTCGAGGTTAACATCTGCTCCTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017894.4-660s21c1
Sequence:CCGGTGGAGGTGACCAGTTTGTAATCTCGAGATTACAAACTGGTCACCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234687    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017894.4-737s21c1
Sequence:CCGGAGAGGCCTCAGGTTGTTATTTCTCGAGAAATAACAACCTGAGGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017894.4-627s21c1
Sequence:CCGGACAGTGCTGTAGCTGTCTTTGCTCGAGCAAAGACAGCTACAGCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017894.4-335s21c1
Sequence:CCGGGATGACTCCTGGGTGCAAGAACTCGAGTTCTTGCACCCAGGAGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009553
ZSCAN2 MISSION shRNA Bacterial Glycerol Stock
zinc finger and SCAN domain containing 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009553.2-345s1c1
Sequence:CCGGCCTTTGGTTCAGGTACCTCAACTCGAGTTGAGGTACCTGAACCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009553.2-1349s1c1
Sequence:CCGGCCTTAATACTCACCAGGGCATCTCGAGATGCCCTGGTGAGTATTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009553.2-2126s1c1
Sequence:CCGGGCACCTGAAAGAGAAGCTTTACTCGAGTAAAGCTTCTCTTTCAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009553.2-773s1c1
Sequence:CCGGACATGGGATGTTCTTGAACATCTCGAGATGTTCAAGAACATCCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009553.2-1418s1c1
Sequence:CCGGCAGTTACAACTCCAACCTGATCTCGAGATCAGGTTGGAGTTGTAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009553.2-999s21c1
Sequence:CCGGAGCCGGAAATCCCACCTTATCCTCGAGGATAAGGTGGGATTTCCGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009553.2-523s21c1
Sequence:CCGGAGGGTGCTCTTGTCCGATTTCCTCGAGGAAATCGGACAAGAGCACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009553
ZSCAN2 MISSION shRNA shRNA Plasmid DNA
zinc finger and SCAN domain containing 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009553.2-345s1c1
Sequence:CCGGCCTTTGGTTCAGGTACCTCAACTCGAGTTGAGGTACCTGAACCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009553.2-1349s1c1
Sequence:CCGGCCTTAATACTCACCAGGGCATCTCGAGATGCCCTGGTGAGTATTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009553.2-2126s1c1
Sequence:CCGGGCACCTGAAAGAGAAGCTTTACTCGAGTAAAGCTTCTCTTTCAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009553.2-773s1c1
Sequence:CCGGACATGGGATGTTCTTGAACATCTCGAGATGTTCAAGAACATCCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009553.2-1418s1c1
Sequence:CCGGCAGTTACAACTCCAACCTGATCTCGAGATCAGGTTGGAGTTGTAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009553.2-999s21c1
Sequence:CCGGAGCCGGAAATCCCACCTTATCCTCGAGGATAAGGTGGGATTTCCGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009553.2-523s21c1
Sequence:CCGGAGGGTGCTCTTGTCCGATTTCCTCGAGGAAATCGGACAAGAGCACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009553
ZSCAN2 MISSION shRNA Lentiviral Transduction Particles
zinc finger and SCAN domain containing 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009553.2-345s1c1
Sequence:CCGGCCTTTGGTTCAGGTACCTCAACTCGAGTTGAGGTACCTGAACCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009553.2-1349s1c1
Sequence:CCGGCCTTAATACTCACCAGGGCATCTCGAGATGCCCTGGTGAGTATTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009553.2-2126s1c1
Sequence:CCGGGCACCTGAAAGAGAAGCTTTACTCGAGTAAAGCTTCTCTTTCAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009553.2-773s1c1
Sequence:CCGGACATGGGATGTTCTTGAACATCTCGAGATGTTCAAGAACATCCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009553.2-1418s1c1
Sequence:CCGGCAGTTACAACTCCAACCTGATCTCGAGATCAGGTTGGAGTTGTAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009553.2-999s21c1
Sequence:CCGGAGCCGGAAATCCCACCTTATCCTCGAGGATAAGGTGGGATTTCCGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009553.2-523s21c1
Sequence:CCGGAGGGTGCTCTTGTCCGATTTCCTCGAGGAAATCGGACAAGAGCACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks