EMAIL THIS PAGE TO A FRIEND

ZSCAN30

zinc finger and SCAN domain containing 30

Synonyms: ZNF397OS ZNF917
UniProtKB ID: Q86W11, B4E0N0, Q6ZNB3, Q96PN3
Gene ID:
Mouse(328918) zinc finger and SCAN domain containing 30
Rat(364827) zinc finger and SCAN domain containing 30
naked mole-rat(101707135) zinc finger and SCAN domain containing 30
domestic guinea pig(100735015) zinc finger and SCAN domain containing 30
cow(539119) zinc finger and SCAN domain containing 30
sheep(101116620) zinc finger and SCAN domain containing 30
dog(490486) zinc finger and SCAN domain containing 30
domestic cat(101093212) zinc finger and SCAN domain containing 30
Horse(100066972) zinc finger and SCAN domain containing 30
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001112734 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001112734 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001112734 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001080810 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001080810 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001080810 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001112734 Rosetta Predictions human pricing
XM_001055924 Rosetta Predictions rat pricing
XM_344656 Rosetta Predictions rat pricing
NM_001080810 Rosetta Predictions mouse pricing
XM_283527 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001112734 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325505 predicted 383
2 SASI_Hs02_00325506 predicted 321
3 SASI_Hs02_00325507 predicted 324
4 SASI_Hs02_00325508 predicted 636
5 SASI_Hs02_00325509 predicted 1492
6 SASI_Hs02_00325510 predicted 252
7 SASI_Hs02_00325511 predicted 1028
8 SASI_Hs02_00325512 predicted 276
9 SASI_Hs02_00325513 predicted 942
10 SASI_Hs02_00325514 predicted 1691
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055924 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00281466 predicted 288
2 SASI_Rn02_00281467 predicted 372
3 SASI_Rn02_00281468 predicted 306
4 SASI_Rn02_00281469 predicted 326
5 SASI_Rn02_00281470 predicted 340
6 SASI_Rn02_00281471 predicted 353
7 SASI_Rn02_00281472 predicted 375
8 SASI_Rn02_00281473 predicted 369
9 SASI_Rn02_00281474 predicted 210
10 SASI_Rn02_00281475 predicted 355
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344656 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00397400 predicted 291
2 SASI_Rn02_00397401 predicted 374
3 SASI_Rn02_00397402 predicted 308
4 SASI_Rn02_00397403 predicted 329
5 SASI_Rn02_00397404 predicted 342
6 SASI_Rn02_00397405 predicted 350
7 SASI_Rn02_00397406 predicted 378
8 SASI_Rn02_00397407 predicted 369
9 SASI_Rn02_00397408 predicted 210
10 SASI_Rn02_00397409 predicted 347
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080810 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293843 predicted 232
2 SASI_Mm02_00293844 predicted 228
3 SASI_Mm02_00293845 predicted 226
4 SASI_Mm02_00293846 predicted 323
5 SASI_Mm02_00293847 predicted 237
6 SASI_Mm02_00293848 predicted 356
7 SASI_Mm02_00293849 predicted 439
8 SASI_Mm02_00293850 predicted 276
9 SASI_Mm02_00293851 predicted 371
10 SASI_Mm02_00293852 predicted 243
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_283527 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00222687 predicted 251
2 SASI_Mm01_00222688 predicted 321
3 SASI_Mm01_00222689 predicted 340
4 SASI_Mm01_00222690 predicted 273
5 SASI_Mm01_00222691 predicted 229
6 SASI_Mm01_00222692 predicted 355
7 SASI_Mm01_00222693 predicted 375
8 SASI_Mm01_00222694 predicted 376
9 SASI_Mm01_00222695 predicted 286
10 SASI_Mm01_00222696 predicted 229
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001112734
VALIDATED
ZSCAN30 MISSION shRNA Bacterial Glycerol Stock
zinc finger and SCAN domain containing 30
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001112734.1-1662s21c1
Sequence:CCGGTAGGCATAGGTCAGGCCTTATCTCGAGATAAGGCCTGACCTATGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262438    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001112734.1-1818s21c1
Sequence:CCGGCCTCCCAGTTCGGTACTATAACTCGAGTTATAGTACCGAACTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001112734.1-1693s21c1
Sequence:CCGGAGAACACACACCAGAGTTTAACTCGAGTTAAACTCTGGTGTGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001112734.1-1494s21c1
Sequence:CCGGTGGTAGGAGTTCTATCCTTATCTCGAGATAAGGATAGAACTCCTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001112734.1-916s21c1
Sequence:CCGGGGAGGTCTGGACAACTCTAAGCTCGAGCTTAGAGTTGTCCAGACCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001112734
VALIDATED
ZSCAN30 MISSION shRNA shRNA Plasmid DNA
zinc finger and SCAN domain containing 30
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001112734.1-1662s21c1
Sequence:CCGGTAGGCATAGGTCAGGCCTTATCTCGAGATAAGGCCTGACCTATGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262438    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001112734.1-1818s21c1
Sequence:CCGGCCTCCCAGTTCGGTACTATAACTCGAGTTATAGTACCGAACTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001112734.1-1693s21c1
Sequence:CCGGAGAACACACACCAGAGTTTAACTCGAGTTAAACTCTGGTGTGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001112734.1-1494s21c1
Sequence:CCGGTGGTAGGAGTTCTATCCTTATCTCGAGATAAGGATAGAACTCCTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001112734.1-916s21c1
Sequence:CCGGGGAGGTCTGGACAACTCTAAGCTCGAGCTTAGAGTTGTCCAGACCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001112734
VALIDATED
ZSCAN30 MISSION shRNA Lentiviral Transduction Particles
zinc finger and SCAN domain containing 30
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001112734.1-1662s21c1
Sequence:CCGGTAGGCATAGGTCAGGCCTTATCTCGAGATAAGGCCTGACCTATGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262438    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001112734.1-1818s21c1
Sequence:CCGGCCTCCCAGTTCGGTACTATAACTCGAGTTATAGTACCGAACTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001112734.1-1693s21c1
Sequence:CCGGAGAACACACACCAGAGTTTAACTCGAGTTAAACTCTGGTGTGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001112734.1-1494s21c1
Sequence:CCGGTGGTAGGAGTTCTATCCTTATCTCGAGATAAGGATAGAACTCCTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001112734.1-916s21c1
Sequence:CCGGGGAGGTCTGGACAACTCTAAGCTCGAGCTTAGAGTTGTCCAGACCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080810
ZSCAN30 MISSION shRNA Bacterial Glycerol Stock
zinc finger and SCAN domain containing 30
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080810.1-503s21c1
Sequence:CCGGCTCTTAGCTGCACTCAGTCACCTCGAGGTGACTGAGTGCAGCTAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080810.1-244s21c1
Sequence:CCGGCAGTTTGGTTACTCTGATTTCCTCGAGGAAATCAGAGTAACCAAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080810.1-460s21c1
Sequence:GTACCGGGAGCTAGAGAGAGAATTTGATCTCGAGATCAAATTCTCTCTCTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080810.1-174s21c1
Sequence:CCGGTGTTTGGAAGCAGGACTTAAGCTCGAGCTTAAGTCCTGCTTCCAAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080810.1-375s21c1
Sequence:CCGGCATGACCATCTTGCCTATGGACTCGAGTCCATAGGCAAGATGGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080810.1-285s21c1
Sequence:CCGGGAACCGACTGCAGAAGCTTTGCTCGAGCAAAGCTTCTGCAGTCGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080810.1-230s21c1
Sequence:CCGGGTCAGCAGTTTAGACAGTTTGCTCGAGCAAACTGTCTAAACTGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080810.1-137s21c1
Sequence:CCGGATAGGCTCAACTTTGTGAAAGCTCGAGCTTTCACAAAGTTGAGCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080810.1-329s21c1
Sequence:CCGGAGCACTCTAAGGAGCAGATCCCTCGAGGGATCTGCTCCTTAGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080810.1-410s21c1
Sequence:CCGGTGCAAGAACACAGGCCCAGAACTCGAGTTCTGGGCCTGTGTTCTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080810
ZSCAN30 MISSION shRNA shRNA Plasmid DNA
zinc finger and SCAN domain containing 30
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080810.1-503s21c1
Sequence:CCGGCTCTTAGCTGCACTCAGTCACCTCGAGGTGACTGAGTGCAGCTAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080810.1-244s21c1
Sequence:CCGGCAGTTTGGTTACTCTGATTTCCTCGAGGAAATCAGAGTAACCAAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080810.1-460s21c1
Sequence:GTACCGGGAGCTAGAGAGAGAATTTGATCTCGAGATCAAATTCTCTCTCTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080810.1-174s21c1
Sequence:CCGGTGTTTGGAAGCAGGACTTAAGCTCGAGCTTAAGTCCTGCTTCCAAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080810.1-375s21c1
Sequence:CCGGCATGACCATCTTGCCTATGGACTCGAGTCCATAGGCAAGATGGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080810.1-285s21c1
Sequence:CCGGGAACCGACTGCAGAAGCTTTGCTCGAGCAAAGCTTCTGCAGTCGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080810.1-230s21c1
Sequence:CCGGGTCAGCAGTTTAGACAGTTTGCTCGAGCAAACTGTCTAAACTGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080810.1-137s21c1
Sequence:CCGGATAGGCTCAACTTTGTGAAAGCTCGAGCTTTCACAAAGTTGAGCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080810.1-329s21c1
Sequence:CCGGAGCACTCTAAGGAGCAGATCCCTCGAGGGATCTGCTCCTTAGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080810.1-410s21c1
Sequence:CCGGTGCAAGAACACAGGCCCAGAACTCGAGTTCTGGGCCTGTGTTCTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080810
ZSCAN30 MISSION shRNA Lentiviral Transduction Particles
zinc finger and SCAN domain containing 30
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080810.1-503s21c1
Sequence:CCGGCTCTTAGCTGCACTCAGTCACCTCGAGGTGACTGAGTGCAGCTAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080810.1-244s21c1
Sequence:CCGGCAGTTTGGTTACTCTGATTTCCTCGAGGAAATCAGAGTAACCAAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080810.1-460s21c1
Sequence:GTACCGGGAGCTAGAGAGAGAATTTGATCTCGAGATCAAATTCTCTCTCTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080810.1-174s21c1
Sequence:CCGGTGTTTGGAAGCAGGACTTAAGCTCGAGCTTAAGTCCTGCTTCCAAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080810.1-375s21c1
Sequence:CCGGCATGACCATCTTGCCTATGGACTCGAGTCCATAGGCAAGATGGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080810.1-285s21c1
Sequence:CCGGGAACCGACTGCAGAAGCTTTGCTCGAGCAAAGCTTCTGCAGTCGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080810.1-230s21c1
Sequence:CCGGGTCAGCAGTTTAGACAGTTTGCTCGAGCAAACTGTCTAAACTGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080810.1-137s21c1
Sequence:CCGGATAGGCTCAACTTTGTGAAAGCTCGAGCTTTCACAAAGTTGAGCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080810.1-329s21c1
Sequence:CCGGAGCACTCTAAGGAGCAGATCCCTCGAGGGATCTGCTCCTTAGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080810.1-410s21c1
Sequence:CCGGTGCAAGAACACAGGCCCAGAACTCGAGTTCTGGGCCTGTGTTCTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks