EMAIL THIS PAGE TO A FRIEND

ZSCAN31

zinc finger and SCAN domain containing 31

Synonyms: ZNF20-Lp ZNF310P ZNF323 dJ874C20.2
Species: Human ZSCAN31(64288)
UniProtKB ID: Q96LW9, Q6P178, Q8WWS5
Gene ID:
Human(64288) Summary: ZNF323 is a member of the subfamily of C2H2 Kruppel-like zinc finger transcription factors that have a SCAN box domain (Pi et al., 2002 [PubMed 12147252]
37 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030899 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030899 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030899 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU072341 MISSION® esiRNA esiRNA human ZNF323 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030899 Rosetta Predictions human pricing
NM_145909 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030899 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056696 predicted 801
2 SASI_Hs01_00056697 predicted 1377
3 SASI_Hs01_00056698 predicted 1466
4 SASI_Hs02_00358430 predicted 1118
5 SASI_Hs01_00056699 predicted 1366
6 SASI_Hs01_00056700 predicted 918
7 SASI_Hs01_00056701 predicted 1236
8 SASI_Hs01_00056702 predicted 1405
9 SASI_Hs01_00056703 predicted 905
10 SASI_Hs01_00056704 predicted 1305
11 SASI_Hs01_00056695 predicted 1345
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145909 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186738 predicted 908
2 SASI_Hs02_00365445 predicted 1762
3 SASI_Hs01_00186740 predicted 1170
4 SASI_Hs01_00186741 predicted 1739
5 SASI_Hs01_00186742 predicted 1831
6 SASI_Hs02_00365446 predicted 1481
7 SASI_Hs01_00186743 predicted 1281
8 SASI_Hs01_00186744 predicted 1602
9 SASI_Hs01_00186746 predicted 1262
10 SASI_Hs02_00365447 predicted 1674
11 SASI_Hs01_00186737 predicted 1706
12 SASI_Hs01_00186739 predicted 1087
13 SASI_Hs01_00186745 predicted 1048
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030899
ZSCAN31 MISSION shRNA Bacterial Glycerol Stock
zinc finger and SCAN domain containing 31
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030899.3-873s21c1
Sequence:CCGGACGCCACAGGTGCAATGAATGCTCGAGCATTCATTGCACCTGTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030899.3-1326s21c1
Sequence:CCGGTAGTAAGCGGACACTTCTTAACTCGAGTTAAGAAGTGTCCGCTTACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030899.3-813s21c1
Sequence:GTACCGGAGAAACTTGTAAACGAGACAGCTCGAGCTGTCTCGTTTACAAGTTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217967    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030899.3-1410s21c1
Sequence:GTACCGGGTCATCATTGCAACCTTATTACTCGAGTAATAAGGTTGCAATGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030899.3-908s21c1
Sequence:CCGGCTAAGAGTTCAGTACTCATTGCTCGAGCAATGAGTACTGAACTCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030899.2-881s1c1
Sequence:CCGGAGGTGCAATGAATGTGGGAAACTCGAGTTTCCCACATTCATTGCACCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030899.2-1312s1c1
Sequence:CCGGGTGCAGTAAACTCTTTAGTAACTCGAGTTACTAAAGAGTTTACTGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030899.2-1334s1c1
Sequence:CCGGCGGACACTTCTTAAGAAACATCTCGAGATGTTTCTTAAGAAGTGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030899.2-786s1c1
Sequence:CCGGGAGATGTATCTTTGGATTCTACTCGAGTAGAATCCAAAGATACATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030899.2-1242s1c1
Sequence:CCGGTCATTCAGAATGCAGGGCTTTCTCGAGAAAGCCCTGCATTCTGAATGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030899
ZSCAN31 MISSION shRNA shRNA Plasmid DNA
zinc finger and SCAN domain containing 31
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030899.3-873s21c1
Sequence:CCGGACGCCACAGGTGCAATGAATGCTCGAGCATTCATTGCACCTGTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030899.3-1326s21c1
Sequence:CCGGTAGTAAGCGGACACTTCTTAACTCGAGTTAAGAAGTGTCCGCTTACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030899.3-813s21c1
Sequence:GTACCGGAGAAACTTGTAAACGAGACAGCTCGAGCTGTCTCGTTTACAAGTTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217967    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030899.3-1410s21c1
Sequence:GTACCGGGTCATCATTGCAACCTTATTACTCGAGTAATAAGGTTGCAATGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030899.3-908s21c1
Sequence:CCGGCTAAGAGTTCAGTACTCATTGCTCGAGCAATGAGTACTGAACTCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030899.2-881s1c1
Sequence:CCGGAGGTGCAATGAATGTGGGAAACTCGAGTTTCCCACATTCATTGCACCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030899.2-1312s1c1
Sequence:CCGGGTGCAGTAAACTCTTTAGTAACTCGAGTTACTAAAGAGTTTACTGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030899.2-1334s1c1
Sequence:CCGGCGGACACTTCTTAAGAAACATCTCGAGATGTTTCTTAAGAAGTGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030899.2-786s1c1
Sequence:CCGGGAGATGTATCTTTGGATTCTACTCGAGTAGAATCCAAAGATACATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030899.2-1242s1c1
Sequence:CCGGTCATTCAGAATGCAGGGCTTTCTCGAGAAAGCCCTGCATTCTGAATGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030899
ZSCAN31 MISSION shRNA Lentiviral Transduction Particles
zinc finger and SCAN domain containing 31
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030899.3-873s21c1
Sequence:CCGGACGCCACAGGTGCAATGAATGCTCGAGCATTCATTGCACCTGTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030899.3-1326s21c1
Sequence:CCGGTAGTAAGCGGACACTTCTTAACTCGAGTTAAGAAGTGTCCGCTTACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030899.3-813s21c1
Sequence:GTACCGGAGAAACTTGTAAACGAGACAGCTCGAGCTGTCTCGTTTACAAGTTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217967    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030899.3-1410s21c1
Sequence:GTACCGGGTCATCATTGCAACCTTATTACTCGAGTAATAAGGTTGCAATGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030899.3-908s21c1
Sequence:CCGGCTAAGAGTTCAGTACTCATTGCTCGAGCAATGAGTACTGAACTCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030899.2-881s1c1
Sequence:CCGGAGGTGCAATGAATGTGGGAAACTCGAGTTTCCCACATTCATTGCACCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030899.2-1312s1c1
Sequence:CCGGGTGCAGTAAACTCTTTAGTAACTCGAGTTACTAAAGAGTTTACTGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030899.2-1334s1c1
Sequence:CCGGCGGACACTTCTTAAGAAACATCTCGAGATGTTTCTTAAGAAGTGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030899.2-786s1c1
Sequence:CCGGGAGATGTATCTTTGGATTCTACTCGAGTAGAATCCAAAGATACATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030899.2-1242s1c1
Sequence:CCGGTCATTCAGAATGCAGGGCTTTCTCGAGAAAGCCCTGCATTCTGAATGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks