EMAIL THIS PAGE TO A FRIEND

ZSCAN32

zinc finger and SCAN domain containing 32

Synonyms: ZNF434
Species: Human ZSCAN32(54925)
UniProtKB ID: Q9NX65, Q6WMU8, Q7Z6G2, Q8NFX8, Q9BU74
Gene ID:
23 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017810 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017810 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017810 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU108111 MISSION® esiRNA esiRNA human AC025283.6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017810 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017810 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232895 predicted 2262
2 SASI_Hs01_00232896 predicted 1759
3 SASI_Hs01_00232897 predicted 959
4 SASI_Hs02_00350673 predicted 1434
5 SASI_Hs02_00350674 predicted 1237
6 SASI_Hs01_00232898 predicted 2140
7 SASI_Hs01_00232899 predicted 1718
8 SASI_Hs01_00232900 predicted 1629
9 SASI_Hs01_00232901 predicted 1751
10 SASI_Hs01_00232902 predicted 1482
11 SASI_Hs01_00232903 predicted 1601
12 SASI_Hs01_00232904 predicted 968
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017810
VALIDATED
ZSCAN32 MISSION shRNA Bacterial Glycerol Stock
zinc finger and SCAN domain containing 32
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_017810.2-1102s1c1
Sequence:CCGGCCTACAGTTGAGTTACCGCAACTCGAGTTGCGGTAACTCAACTGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017810.2-1993s1c1
Sequence:CCGGCTGTGGAAAGAGATTCAACAACTCGAGTTGTTGAATCTCTTTCCACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017810.2-1406s1c1
Sequence:CCGGGAGTTCAAGAACGAGATTAAACTCGAGTTTAATCTCGTTCTTGAACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_017810.2-962s1c1
Sequence:CCGGGCTATTCTTAGTAGTTCTCAACTCGAGTTGAGAACTACTAAGAATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_017810.2-1767s1c1
Sequence:CCGGCTTATCTTGTTCGGCATCAAACTCGAGTTTGATGCCGAACAAGATAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017810.2-2253s21c1
Sequence:CCGGCGTTATGAGTGTGTCGGTAAACTCGAGTTTACCGACACACTCATAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417128    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017810.2-2485s21c1
Sequence:CCGGGAAAGCTGTAGGATCCATAAACTCGAGTTTATGGATCCTACAGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017810.2-1485s21c1
Sequence:CCGGGAAAGTCCAGAGGAGTTTATTCTCGAGAATAAACTCCTCTGGACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419533    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017810.2-2570s21c1
Sequence:CCGGACACTTTCTGGGCTAACATAGCTCGAGCTATGTTAGCCCAGAAAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017810.2-1548s21c1
Sequence:CCGGCAAGAAGGCAATGTAGAAATTCTCGAGAATTTCTACATTGCCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017810.2-1723s21c1
Sequence:CCGGAGTATCTCAATGTCCTGAATGCTCGAGCATTCAGGACATTGAGATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017810.2-1447s21c1
Sequence:CCGGTGATTCAGAGGAAGTAGAAATCTCGAGATTTCTACTTCCTCTGAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017810
VALIDATED
ZSCAN32 MISSION shRNA shRNA Plasmid DNA
zinc finger and SCAN domain containing 32
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_017810.2-1102s1c1
Sequence:CCGGCCTACAGTTGAGTTACCGCAACTCGAGTTGCGGTAACTCAACTGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017810.2-1993s1c1
Sequence:CCGGCTGTGGAAAGAGATTCAACAACTCGAGTTGTTGAATCTCTTTCCACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017810.2-1406s1c1
Sequence:CCGGGAGTTCAAGAACGAGATTAAACTCGAGTTTAATCTCGTTCTTGAACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_017810.2-962s1c1
Sequence:CCGGGCTATTCTTAGTAGTTCTCAACTCGAGTTGAGAACTACTAAGAATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_017810.2-1767s1c1
Sequence:CCGGCTTATCTTGTTCGGCATCAAACTCGAGTTTGATGCCGAACAAGATAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017810.2-2253s21c1
Sequence:CCGGCGTTATGAGTGTGTCGGTAAACTCGAGTTTACCGACACACTCATAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417128    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017810.2-2485s21c1
Sequence:CCGGGAAAGCTGTAGGATCCATAAACTCGAGTTTATGGATCCTACAGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017810.2-1485s21c1
Sequence:CCGGGAAAGTCCAGAGGAGTTTATTCTCGAGAATAAACTCCTCTGGACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419533    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017810.2-2570s21c1
Sequence:CCGGACACTTTCTGGGCTAACATAGCTCGAGCTATGTTAGCCCAGAAAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017810.2-1548s21c1
Sequence:CCGGCAAGAAGGCAATGTAGAAATTCTCGAGAATTTCTACATTGCCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017810.2-1723s21c1
Sequence:CCGGAGTATCTCAATGTCCTGAATGCTCGAGCATTCAGGACATTGAGATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017810.2-1447s21c1
Sequence:CCGGTGATTCAGAGGAAGTAGAAATCTCGAGATTTCTACTTCCTCTGAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017810
VALIDATED
ZSCAN32 MISSION shRNA Lentiviral Transduction Particles
zinc finger and SCAN domain containing 32
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_017810.2-1102s1c1
Sequence:CCGGCCTACAGTTGAGTTACCGCAACTCGAGTTGCGGTAACTCAACTGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017810.2-1993s1c1
Sequence:CCGGCTGTGGAAAGAGATTCAACAACTCGAGTTGTTGAATCTCTTTCCACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017810.2-1406s1c1
Sequence:CCGGGAGTTCAAGAACGAGATTAAACTCGAGTTTAATCTCGTTCTTGAACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_017810.2-962s1c1
Sequence:CCGGGCTATTCTTAGTAGTTCTCAACTCGAGTTGAGAACTACTAAGAATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_017810.2-1767s1c1
Sequence:CCGGCTTATCTTGTTCGGCATCAAACTCGAGTTTGATGCCGAACAAGATAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017810.2-2253s21c1
Sequence:CCGGCGTTATGAGTGTGTCGGTAAACTCGAGTTTACCGACACACTCATAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417128    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017810.2-2485s21c1
Sequence:CCGGGAAAGCTGTAGGATCCATAAACTCGAGTTTATGGATCCTACAGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017810.2-1485s21c1
Sequence:CCGGGAAAGTCCAGAGGAGTTTATTCTCGAGAATAAACTCCTCTGGACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419533    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017810.2-2570s21c1
Sequence:CCGGACACTTTCTGGGCTAACATAGCTCGAGCTATGTTAGCCCAGAAAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017810.2-1548s21c1
Sequence:CCGGCAAGAAGGCAATGTAGAAATTCTCGAGAATTTCTACATTGCCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017810.2-1723s21c1
Sequence:CCGGAGTATCTCAATGTCCTGAATGCTCGAGCATTCAGGACATTGAGATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017810.2-1447s21c1
Sequence:CCGGTGATTCAGAGGAAGTAGAAATCTCGAGATTTCTACTTCCTCTGAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks