EMAIL THIS PAGE TO A FRIEND

ZSCAN4

zinc finger and SCAN domain containing 4

Synonyms: ZNF494
UniProtKB ID: Q8NAM6, Q3MIQ2
Gene ID:
Human(201516) Summary: The ZSCAN4 gene encodes a protein involved in telomere maintenance and with a key role in the critical feature of mouse embryonic stem (ES) cells, namely, defying cellular senescence and maintaining normal karyotype for many cell divisions in culture (Zalzman et al., 2010 [PubMed 20336070]
domestic cat(101097361) zinc finger and SCAN domain containing 4
cow(101907571) zinc finger and SCAN domain containing 4
24 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152677 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152677 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152677 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152677 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152677 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100912 predicted 1695
2 SASI_Hs01_00100913 predicted 1656
3 SASI_Hs01_00100915 predicted 1667
4 SASI_Hs01_00100916 predicted 825
5 SASI_Hs01_00100917 predicted 798
6 SASI_Hs02_00366569 predicted 1584
7 SASI_Hs01_00100918 predicted 1477
8 SASI_Hs01_00100919 predicted 1144
9 SASI_Hs01_00100920 predicted 935
10 SASI_Hs02_00366570 predicted 940
11 SASI_Hs01_00100914 predicted 1347
12 SASI_Hs01_00100921 predicted 1232
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152677
ZSCAN4 MISSION shRNA Bacterial Glycerol Stock
zinc finger and SCAN domain containing 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152677.2-823s21c1
Sequence:CCGGCTCAAGAATGGTGCTCAATTCCTCGAGGAATTGAGCACCATTCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152677.2-1662s21c1
Sequence:CCGGAGTATCTCTGTCACTTATTAGCTCGAGCTAATAAGTGACAGAGATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152677.2-955s21c1
Sequence:CCGGATTAGTCCTGGAGCAGTTTATCTCGAGATAAACTGCTCCAGGACTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152677.1-1759s1c1
Sequence:CCGGCTACGGGTGCATCAGATAATTCTCGAGAATTATCTGATGCACCCGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152677.1-1229s1c1
Sequence:CCGGCCCAAGATACTTCCTTAGAAACTCGAGTTTCTAAGGAAGTATCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152677
ZSCAN4 MISSION shRNA shRNA Plasmid DNA
zinc finger and SCAN domain containing 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152677.2-823s21c1
Sequence:CCGGCTCAAGAATGGTGCTCAATTCCTCGAGGAATTGAGCACCATTCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152677.2-1662s21c1
Sequence:CCGGAGTATCTCTGTCACTTATTAGCTCGAGCTAATAAGTGACAGAGATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152677.2-955s21c1
Sequence:CCGGATTAGTCCTGGAGCAGTTTATCTCGAGATAAACTGCTCCAGGACTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152677.1-1759s1c1
Sequence:CCGGCTACGGGTGCATCAGATAATTCTCGAGAATTATCTGATGCACCCGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152677.1-1229s1c1
Sequence:CCGGCCCAAGATACTTCCTTAGAAACTCGAGTTTCTAAGGAAGTATCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152677
ZSCAN4 MISSION shRNA Lentiviral Transduction Particles
zinc finger and SCAN domain containing 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152677.2-823s21c1
Sequence:CCGGCTCAAGAATGGTGCTCAATTCCTCGAGGAATTGAGCACCATTCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152677.2-1662s21c1
Sequence:CCGGAGTATCTCTGTCACTTATTAGCTCGAGCTAATAAGTGACAGAGATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152677.2-955s21c1
Sequence:CCGGATTAGTCCTGGAGCAGTTTATCTCGAGATAAACTGCTCCAGGACTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152677.1-1759s1c1
Sequence:CCGGCTACGGGTGCATCAGATAATTCTCGAGAATTATCTGATGCACCCGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152677.1-1229s1c1
Sequence:CCGGCCCAAGATACTTCCTTAGAAACTCGAGTTTCTAAGGAAGTATCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks