EMAIL THIS PAGE TO A FRIEND

ZSCAN5A

zinc finger and SCAN domain containing 5A

Synonyms: ZNF495 ZSCAN5
Species: Human ZSCAN5A(79149)
UniProtKB ID: Q9BUG6, Q49A73, Q53F04, Q8N7B3
Gene ID:
19 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024303 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024303 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024303 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU107541 MISSION® esiRNA esiRNA human ZSCAN5A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024303 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024303 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023663 predicted 900
2 SASI_Hs01_00023664 predicted 1339
3 SASI_Hs01_00023665 predicted 278
4 SASI_Hs01_00023666 predicted 896
5 SASI_Hs01_00023668 predicted 620
6 SASI_Hs01_00023671 predicted 1481
7 SASI_Hs01_00023672 predicted 1566
8 SASI_Hs01_00023667 predicted 1230
9 SASI_Hs01_00023669 predicted 1267
10 SASI_Hs01_00023670 predicted 1640
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024303
VALIDATED
ZSCAN5A MISSION shRNA Bacterial Glycerol Stock
zinc finger and SCAN domain containing 5A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285246    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_024303.1-1760s21c1
Sequence:CCGGCAGAGGGAGTGCCCTAGATATCTCGAGATATCTAGGGCACTCCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024303.1-1348s21c1
Sequence:CCGGGCAGCTTATTAGCCTCCAATTCTCGAGAATTGGAGGCTAATAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_024303.1-1249s21c1
Sequence:CCGGCGAGAAGAGGTTTACGTGTAACTCGAGTTACACGTAAACCTCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_024303.1-1656s21c1
Sequence:CCGGGATTGCATAATCCGGTCTATGCTCGAGCATAGACCGGATTATGCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_024303.1-224s21c1
Sequence:CCGGTTGGAGCTGCCACGGTCTATGCTCGAGCATAGACCGTGGCAGCTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_024303.1-1348s1c1
Sequence:CCGGGCAGCTTATTAGCCTCCAATTCTCGAGAATTGGAGGCTAATAAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_024303.1-1249s1c1
Sequence:CCGGCGAGAAGAGGTTTACGTGTAACTCGAGTTACACGTAAACCTCTTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_024303.1-1603s1c1
Sequence:CCGGGCTGAAATTGTTAAGACGCCACTCGAGTGGCGTCTTAACAATTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024303.1-890s1c1
Sequence:CCGGCTTCCAAAGAGTCCCACAGATCTCGAGATCTGTGGGACTCTTTGGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024303
VALIDATED
ZSCAN5A MISSION shRNA shRNA Plasmid DNA
zinc finger and SCAN domain containing 5A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285246    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_024303.1-1760s21c1
Sequence:CCGGCAGAGGGAGTGCCCTAGATATCTCGAGATATCTAGGGCACTCCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024303.1-1348s21c1
Sequence:CCGGGCAGCTTATTAGCCTCCAATTCTCGAGAATTGGAGGCTAATAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_024303.1-1249s21c1
Sequence:CCGGCGAGAAGAGGTTTACGTGTAACTCGAGTTACACGTAAACCTCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_024303.1-1656s21c1
Sequence:CCGGGATTGCATAATCCGGTCTATGCTCGAGCATAGACCGGATTATGCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_024303.1-224s21c1
Sequence:CCGGTTGGAGCTGCCACGGTCTATGCTCGAGCATAGACCGTGGCAGCTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_024303.1-1348s1c1
Sequence:CCGGGCAGCTTATTAGCCTCCAATTCTCGAGAATTGGAGGCTAATAAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_024303.1-1249s1c1
Sequence:CCGGCGAGAAGAGGTTTACGTGTAACTCGAGTTACACGTAAACCTCTTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_024303.1-1603s1c1
Sequence:CCGGGCTGAAATTGTTAAGACGCCACTCGAGTGGCGTCTTAACAATTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024303.1-890s1c1
Sequence:CCGGCTTCCAAAGAGTCCCACAGATCTCGAGATCTGTGGGACTCTTTGGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024303
VALIDATED
ZSCAN5A MISSION shRNA Lentiviral Transduction Particles
zinc finger and SCAN domain containing 5A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285246    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_024303.1-1760s21c1
Sequence:CCGGCAGAGGGAGTGCCCTAGATATCTCGAGATATCTAGGGCACTCCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024303.1-1348s21c1
Sequence:CCGGGCAGCTTATTAGCCTCCAATTCTCGAGAATTGGAGGCTAATAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_024303.1-1249s21c1
Sequence:CCGGCGAGAAGAGGTTTACGTGTAACTCGAGTTACACGTAAACCTCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_024303.1-1656s21c1
Sequence:CCGGGATTGCATAATCCGGTCTATGCTCGAGCATAGACCGGATTATGCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_024303.1-224s21c1
Sequence:CCGGTTGGAGCTGCCACGGTCTATGCTCGAGCATAGACCGTGGCAGCTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_024303.1-1348s1c1
Sequence:CCGGGCAGCTTATTAGCCTCCAATTCTCGAGAATTGGAGGCTAATAAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_024303.1-1249s1c1
Sequence:CCGGCGAGAAGAGGTTTACGTGTAACTCGAGTTACACGTAAACCTCTTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_024303.1-1603s1c1
Sequence:CCGGGCTGAAATTGTTAAGACGCCACTCGAGTGGCGTCTTAACAATTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024303.1-890s1c1
Sequence:CCGGCTTCCAAAGAGTCCCACAGATCTCGAGATCTGTGGGACTCTTTGGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks