EMAIL THIS PAGE TO A FRIEND

ZSCAN5B

zinc finger and SCAN domain containing 5B

Synonyms: ZNF371 ZNF495B
UniProtKB ID: A6NJL1
Gene ID:
Mouse(170734) zinc finger and SCAN domain containing 5B
Rat(292566) zinc finger and SCAN domain containing 5B
cow(518698) zinc finger and SCAN domain containing 5B
50 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133204 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133204 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133204 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001080456 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080456 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080456 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080456 Rosetta Predictions human pricing
XM_292723 Rosetta Predictions human pricing
XM_218239 Rosetta Predictions rat pricing
NM_133204 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080456 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315016 predicted 1000
2 SASI_Hs02_00315017 predicted 658
3 SASI_Hs02_00315018 predicted 900
4 SASI_Hs02_00315019 predicted 310
5 SASI_Hs02_00315020 predicted 549
6 SASI_Hs02_00315021 predicted 1117
7 SASI_Hs02_00315022 predicted 1154
8 SASI_Hs02_00315023 predicted 1023
9 SASI_Hs02_00315024 predicted 1319
10 SASI_Hs02_00315025 predicted 646
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_292723 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00259533 predicted 1144
2 SASI_Hs01_00259534 predicted 194
3 SASI_Hs01_00259535 predicted 458
4 SASI_Hs01_00259536 predicted 1507
5 SASI_Hs01_00259537 predicted 701
6 SASI_Hs01_00259538 predicted 1649
7 SASI_Hs01_00259539 predicted 1264
8 SASI_Hs01_00259540 predicted 187
9 SASI_Hs01_00259541 predicted 1472
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_218239 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00377573 predicted 873
2 SASI_Rn02_00377574 predicted 662
3 SASI_Rn02_00377575 predicted 494
4 SASI_Rn02_00377576 predicted 336
5 SASI_Rn02_00377577 predicted 599
6 SASI_Rn02_00377578 predicted 627
7 SASI_Rn02_00377579 predicted 965
8 SASI_Rn02_00377580 predicted 406
9 SASI_Rn02_00377581 predicted 612
10 SASI_Rn02_00377582 predicted 994
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133204 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00053780 predicted 344
2 SASI_Mm01_00053781 predicted 1725
3 SASI_Mm01_00053783 predicted 1410
4 SASI_Mm01_00053784 predicted 389
5 SASI_Mm01_00053785 predicted 1471
6 SASI_Mm01_00053786 predicted 1208
7 SASI_Mm01_00053787 predicted 1256
8 SASI_Mm01_00053788 predicted 1150
9 SASI_Mm01_00053789 predicted 1281
10 SASI_Mm02_00338397 predicted 1091
11 SASI_Mm01_00053782 predicted 1171
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133204
ZSCAN5B MISSION shRNA Bacterial Glycerol Stock
zinc finger and SCAN domain containing 5B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133204.1-154s1c1
Sequence:CCGGGAGAAGCAAGTTGACAGTCTTCTCGAGAAGACTGTCAACTTGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095324    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133204.1-642s1c1
Sequence:CCGGCCTAGAAAGACTGAGATTGAACTCGAGTTCAATCTCAGTCTTTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133204.1-184s1c1
Sequence:CCGGGCTCGGTTTCAGTGTACTGAACTCGAGTTCAGTACACTGAAACCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133204.1-507s1c1
Sequence:CCGGCCATTGCAACTTGAGACCCTACTCGAGTAGGGTCTCAAGTTGCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133204.1-276s1c1
Sequence:CCGGCAAGTGCATCTTGTGCAACAACTCGAGTTGTTGCACAAGATGCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133204
ZSCAN5B MISSION shRNA shRNA Plasmid DNA
zinc finger and SCAN domain containing 5B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133204.1-154s1c1
Sequence:CCGGGAGAAGCAAGTTGACAGTCTTCTCGAGAAGACTGTCAACTTGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095324    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133204.1-642s1c1
Sequence:CCGGCCTAGAAAGACTGAGATTGAACTCGAGTTCAATCTCAGTCTTTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133204.1-184s1c1
Sequence:CCGGGCTCGGTTTCAGTGTACTGAACTCGAGTTCAGTACACTGAAACCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133204.1-507s1c1
Sequence:CCGGCCATTGCAACTTGAGACCCTACTCGAGTAGGGTCTCAAGTTGCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133204.1-276s1c1
Sequence:CCGGCAAGTGCATCTTGTGCAACAACTCGAGTTGTTGCACAAGATGCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133204
ZSCAN5B MISSION shRNA Lentiviral Transduction Particles
zinc finger and SCAN domain containing 5B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133204.1-154s1c1
Sequence:CCGGGAGAAGCAAGTTGACAGTCTTCTCGAGAAGACTGTCAACTTGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095324    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133204.1-642s1c1
Sequence:CCGGCCTAGAAAGACTGAGATTGAACTCGAGTTCAATCTCAGTCTTTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133204.1-184s1c1
Sequence:CCGGGCTCGGTTTCAGTGTACTGAACTCGAGTTCAGTACACTGAAACCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133204.1-507s1c1
Sequence:CCGGCCATTGCAACTTGAGACCCTACTCGAGTAGGGTCTCAAGTTGCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133204.1-276s1c1
Sequence:CCGGCAAGTGCATCTTGTGCAACAACTCGAGTTGTTGCACAAGATGCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080456
ZSCAN5B MISSION shRNA Bacterial Glycerol Stock
zinc finger and SCAN domain containing 5B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080456.1-301s21c1
Sequence:CCGGAGAAATGGTCTATAGTCAACTCTCGAGAGTTGACTATAGACCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080456.1-1082s21c1
Sequence:CCGGTCTCTGTCGGAAGCGCTTCTTCTCGAGAAGAAGCGCTTCCGACAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080456.1-323s21c1
Sequence:GTACCGGGCTCGGCAAAGAATATCTTATCTCGAGATAAGATATTCTTTGCCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080456.1-660s21c1
Sequence:CCGGCCCAATCTGGTGAGAGCAAAGCTCGAGCTTTGCTCTCACCAGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080456.1-999s21c1
Sequence:CCGGGTGTGCAATAAATCATTTAAGCTCGAGCTTAAATGATTTATTGCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080456
ZSCAN5B MISSION shRNA shRNA Plasmid DNA
zinc finger and SCAN domain containing 5B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080456.1-301s21c1
Sequence:CCGGAGAAATGGTCTATAGTCAACTCTCGAGAGTTGACTATAGACCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080456.1-1082s21c1
Sequence:CCGGTCTCTGTCGGAAGCGCTTCTTCTCGAGAAGAAGCGCTTCCGACAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080456.1-323s21c1
Sequence:GTACCGGGCTCGGCAAAGAATATCTTATCTCGAGATAAGATATTCTTTGCCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080456.1-660s21c1
Sequence:CCGGCCCAATCTGGTGAGAGCAAAGCTCGAGCTTTGCTCTCACCAGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080456.1-999s21c1
Sequence:CCGGGTGTGCAATAAATCATTTAAGCTCGAGCTTAAATGATTTATTGCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080456
ZSCAN5B MISSION shRNA Lentiviral Transduction Particles
zinc finger and SCAN domain containing 5B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080456.1-301s21c1
Sequence:CCGGAGAAATGGTCTATAGTCAACTCTCGAGAGTTGACTATAGACCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080456.1-1082s21c1
Sequence:CCGGTCTCTGTCGGAAGCGCTTCTTCTCGAGAAGAAGCGCTTCCGACAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080456.1-323s21c1
Sequence:GTACCGGGCTCGGCAAAGAATATCTTATCTCGAGATAAGATATTCTTTGCCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080456.1-660s21c1
Sequence:CCGGCCCAATCTGGTGAGAGCAAAGCTCGAGCTTTGCTCTCACCAGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080456.1-999s21c1
Sequence:CCGGGTGTGCAATAAATCATTTAAGCTCGAGCTTAAATGATTTATTGCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks