EMAIL THIS PAGE TO A FRIEND

ZSCAN9

zinc finger and SCAN domain containing 9

Synonyms: PRD51 ZNF193
Species: Human ZSCAN9(7746), domestic guinea pig Zscan9(101787683), naked mole-rat Zscan9(101721944)
UniProtKB ID: O15535, B4E1W6, E7EVQ2, Q2TTR1
Gene ID:
domestic guinea pig(101787683) zinc finger and SCAN domain containing 9
naked mole-rat(101721944) zinc finger and SCAN domain containing 9
29 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006299 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006299 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006299 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU043781 MISSION® esiRNA esiRNA human ZNF193 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006299 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006299 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00341310 predicted 287
2 SASI_Hs02_00341311 predicted 269
3 SASI_Hs01_00123209 predicted 758
4 SASI_Hs02_00341312 predicted 248
5 SASI_Hs02_00341313 predicted 347
6 SASI_Hs01_00123211 predicted 586
7 SASI_Hs01_00123212 predicted 1182
8 SASI_Hs01_00123215 predicted 721
9 SASI_Hs01_00123216 predicted 843
10 SASI_Hs01_00123217 predicted 833
11 SASI_Hs01_00123210 predicted 1200
12 SASI_Hs01_00123213 predicted 679
13 SASI_Hs01_00123214 predicted 1272
14 SASI_Hs01_00123218 predicted 1055
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006299
ZSCAN9 MISSION shRNA Bacterial Glycerol Stock
zinc finger and SCAN domain containing 9
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006299.3-402s21c1
Sequence:CCGGTGAGCACAAAGGAGCAGATTTCTCGAGAAATCTGCTCCTTTGTGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006299.3-939s21c1
Sequence:CCGGCTCAGAGCTCAGGTCTCATTCCTCGAGGAATGAGACCTGAGCTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013018    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006299.2-1414s1c1
Sequence:CCGGCCTTTCTCCATGAAATGTGTTCTCGAGAACACATTTCATGGAGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006299.2-1194s1c1
Sequence:CCGGCGGCGTTCATTTCTCATTGAACTCGAGTTCAATGAGAAATGAACGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006299.2-768s1c1
Sequence:CCGGCCTAAGATAGTGGAACCACATCTCGAGATGTGGTTCCACTATCTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006299.2-1058s1c1
Sequence:CCGGCCACAATATACAGAAACGGTACTCGAGTACCGTTTCTGTATATTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006299.2-586s1c1
Sequence:CCGGACAGACAAGAAGTCCTCTGTACTCGAGTACAGAGGACTTCTTGTCTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006299
ZSCAN9 MISSION shRNA shRNA Plasmid DNA
zinc finger and SCAN domain containing 9
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006299.3-402s21c1
Sequence:CCGGTGAGCACAAAGGAGCAGATTTCTCGAGAAATCTGCTCCTTTGTGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006299.3-939s21c1
Sequence:CCGGCTCAGAGCTCAGGTCTCATTCCTCGAGGAATGAGACCTGAGCTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013018    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006299.2-1414s1c1
Sequence:CCGGCCTTTCTCCATGAAATGTGTTCTCGAGAACACATTTCATGGAGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006299.2-1194s1c1
Sequence:CCGGCGGCGTTCATTTCTCATTGAACTCGAGTTCAATGAGAAATGAACGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006299.2-768s1c1
Sequence:CCGGCCTAAGATAGTGGAACCACATCTCGAGATGTGGTTCCACTATCTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006299.2-1058s1c1
Sequence:CCGGCCACAATATACAGAAACGGTACTCGAGTACCGTTTCTGTATATTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006299.2-586s1c1
Sequence:CCGGACAGACAAGAAGTCCTCTGTACTCGAGTACAGAGGACTTCTTGTCTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006299
ZSCAN9 MISSION shRNA Lentiviral Transduction Particles
zinc finger and SCAN domain containing 9
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006299.3-402s21c1
Sequence:CCGGTGAGCACAAAGGAGCAGATTTCTCGAGAAATCTGCTCCTTTGTGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006299.3-939s21c1
Sequence:CCGGCTCAGAGCTCAGGTCTCATTCCTCGAGGAATGAGACCTGAGCTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013018    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006299.2-1414s1c1
Sequence:CCGGCCTTTCTCCATGAAATGTGTTCTCGAGAACACATTTCATGGAGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006299.2-1194s1c1
Sequence:CCGGCGGCGTTCATTTCTCATTGAACTCGAGTTCAATGAGAAATGAACGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006299.2-768s1c1
Sequence:CCGGCCTAAGATAGTGGAACCACATCTCGAGATGTGGTTCCACTATCTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006299.2-1058s1c1
Sequence:CCGGCCACAATATACAGAAACGGTACTCGAGTACCGTTTCTGTATATTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006299.2-586s1c1
Sequence:CCGGACAGACAAGAAGTCCTCTGTACTCGAGTACAGAGGACTTCTTGTCTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks