EMAIL THIS PAGE TO A FRIEND

ZSWIM1

zinc finger, SWIM-type containing 1

Synonyms: C20orf162
UniProtKB ID: Q9BR11, Q5JZH2, Q9BR12, Q9BV30
Gene ID:
Mouse(71971) zinc finger SWIM-type containing 1
Rat(311631) zinc finger, SWIM-type containing 1
naked mole-rat(101722253) zinc finger, SWIM-type containing 1
Domestic Rabbit(100339348) zinc finger, SWIM-type containing 1
domestic guinea pig(101787815) zinc finger, SWIM-type containing 1
cow(512243) zinc finger, SWIM-type containing 1
chicken(772015) zinc finger, SWIM-type containing 1
chicken(101751947) zinc finger, SWIM-type containing 1
Horse(100071109) zinc finger, SWIM-type containing 1
domestic cat(101086298) zinc finger, SWIM-type containing 1
dog(485902) zinc finger, SWIM-type containing 1
chicken(101665373) zinc finger, SWIM-type containing 1
50 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080603 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080603 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080603 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028028 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028028 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028028 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080603 Rosetta Predictions human pricing
XM_230846 Rosetta Predictions rat pricing
NM_028028 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080603 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085876 predicted 217
2 SASI_Hs01_00085877 predicted 280
3 SASI_Hs02_00362338 predicted 244
4 SASI_Hs01_00085878 predicted 299
5 SASI_Hs01_00085879 predicted 942
6 SASI_Hs01_00085880 predicted 636
7 SASI_Hs01_00085881 predicted 629
8 SASI_Hs01_00085883 predicted 536
9 SASI_Hs01_00085884 predicted 671
10 SASI_Hs01_00085885 predicted 298
11 SASI_Hs01_00085882 predicted 619
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_230846 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00386502 predicted 218
2 SASI_Rn02_00386503 predicted 477
3 SASI_Rn02_00386504 predicted 314
4 SASI_Rn02_00386505 predicted 647
5 SASI_Rn02_00386506 predicted 1120
6 SASI_Rn02_00386507 predicted 1486
7 SASI_Rn02_00386508 predicted 365
8 SASI_Rn02_00386509 predicted 253
9 SASI_Rn02_00386510 predicted 509
10 SASI_Rn02_00386511 predicted 246
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028028 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00094432 predicted 1086
2 SASI_Mm01_00094433 predicted 2006
3 SASI_Mm01_00094434 predicted 785
4 SASI_Mm01_00094435 predicted 1093
5 SASI_Mm01_00094436 predicted 675
6 SASI_Mm01_00094437 predicted 1988
7 SASI_Mm01_00094438 predicted 1841
8 SASI_Mm01_00094439 predicted 1328
9 SASI_Mm01_00094440 predicted 1847
10 SASI_Mm01_00094441 predicted 822
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080603
VALIDATED
ZSWIM1 MISSION shRNA Bacterial Glycerol Stock
zinc finger, SWIM-type containing 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000129703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_080603.2-687s1c1
Sequence:CCGGCCTGAGAAAGTTGTATACACTCTCGAGAGTGTATACAACTTTCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_080603.2-1161s1c1
Sequence:CCGGCCTGGAAGATACCCATAAGGTCTCGAGACCTTATGGGTATCTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_080603.2-438s1c1
Sequence:CCGGCCAGATGTTCCAAGTATTCAACTCGAGTTGAATACTTGGAACATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080603.2-294s1c1
Sequence:CCGGCTTATTTATCCACCGGACCTACTCGAGTAGGTCCGGTGGATAAATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_080603.2-573s1c1
Sequence:CCGGCCACATTTGTAAGTTCCTCCACTCGAGTGGAGGAACTTACAAATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080603.4-1556s21c1
Sequence:CCGGGCAGGTCCAACTCTGATTATTCTCGAGAATAATCAGAGTTGGACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080603.4-317s21c1
Sequence:CCGGGCAAAGTGTCTTTGACCATTTCTCGAGAAATGGTCAAAGACACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080603
VALIDATED
ZSWIM1 MISSION shRNA shRNA Plasmid DNA
zinc finger, SWIM-type containing 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000129703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_080603.2-687s1c1
Sequence:CCGGCCTGAGAAAGTTGTATACACTCTCGAGAGTGTATACAACTTTCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_080603.2-1161s1c1
Sequence:CCGGCCTGGAAGATACCCATAAGGTCTCGAGACCTTATGGGTATCTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_080603.2-438s1c1
Sequence:CCGGCCAGATGTTCCAAGTATTCAACTCGAGTTGAATACTTGGAACATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080603.2-294s1c1
Sequence:CCGGCTTATTTATCCACCGGACCTACTCGAGTAGGTCCGGTGGATAAATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_080603.2-573s1c1
Sequence:CCGGCCACATTTGTAAGTTCCTCCACTCGAGTGGAGGAACTTACAAATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080603.4-1556s21c1
Sequence:CCGGGCAGGTCCAACTCTGATTATTCTCGAGAATAATCAGAGTTGGACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080603.4-317s21c1
Sequence:CCGGGCAAAGTGTCTTTGACCATTTCTCGAGAAATGGTCAAAGACACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080603
VALIDATED
ZSWIM1 MISSION shRNA Lentiviral Transduction Particles
zinc finger, SWIM-type containing 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000129703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_080603.2-687s1c1
Sequence:CCGGCCTGAGAAAGTTGTATACACTCTCGAGAGTGTATACAACTTTCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_080603.2-1161s1c1
Sequence:CCGGCCTGGAAGATACCCATAAGGTCTCGAGACCTTATGGGTATCTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_080603.2-438s1c1
Sequence:CCGGCCAGATGTTCCAAGTATTCAACTCGAGTTGAATACTTGGAACATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080603.2-294s1c1
Sequence:CCGGCTTATTTATCCACCGGACCTACTCGAGTAGGTCCGGTGGATAAATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_080603.2-573s1c1
Sequence:CCGGCCACATTTGTAAGTTCCTCCACTCGAGTGGAGGAACTTACAAATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080603.4-1556s21c1
Sequence:CCGGGCAGGTCCAACTCTGATTATTCTCGAGAATAATCAGAGTTGGACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080603.4-317s21c1
Sequence:CCGGGCAAAGTGTCTTTGACCATTTCTCGAGAAATGGTCAAAGACACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028028
VALIDATED
ZSWIM1 MISSION shRNA Bacterial Glycerol Stock
zinc finger, SWIM-type containing 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028028.2-790s1c1
Sequence:CCGGGCTCATTTCCCTGAGGTCTTACTCGAGTAAGACCTCAGGGAAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028028.2-905s1c1
Sequence:CCGGCTGTGTACTTTGCCATCCCTACTCGAGTAGGGATGGCAAAGTACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028028.2-777s1c1
Sequence:CCGGGCAAGACCTCTTTGCTCATTTCTCGAGAAATGAGCAAAGAGGTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028028.2-1389s1c1
Sequence:CCGGCCCATTTGAGAAACAGGGTATCTCGAGATACCCTGTTTCTCAAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125424    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028028.2-2247s1c1
Sequence:CCGGGCTCAACTTCTGATTGTATTTCTCGAGAAATACAATCAGAAGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028028.2-711s21c1
Sequence:CCGGACCTATGCTGCACCAGATTAGCTCGAGCTAATCTGGTGCAGCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323861    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028028.2-2247s21c1
Sequence:CCGGGCTCAACTTCTGATTGTATTTCTCGAGAAATACAATCAGAAGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028028.2-1993s21c1
Sequence:CCGGGACAACTGGATCGGCCCTTATCTCGAGATAAGGGCCGATCCAGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028028.2-1095s21c1
Sequence:CCGGCAAGTTCCTCCAGGGTAAATTCTCGAGAATTTACCCTGGAGGAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028028.2-1208s21c1
Sequence:CCGGAGCTGTACACGCTCCTGAATACTCGAGTATTCAGGAGCGTGTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028028
VALIDATED
ZSWIM1 MISSION shRNA shRNA Plasmid DNA
zinc finger, SWIM-type containing 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028028.2-790s1c1
Sequence:CCGGGCTCATTTCCCTGAGGTCTTACTCGAGTAAGACCTCAGGGAAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028028.2-905s1c1
Sequence:CCGGCTGTGTACTTTGCCATCCCTACTCGAGTAGGGATGGCAAAGTACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028028.2-777s1c1
Sequence:CCGGGCAAGACCTCTTTGCTCATTTCTCGAGAAATGAGCAAAGAGGTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028028.2-1389s1c1
Sequence:CCGGCCCATTTGAGAAACAGGGTATCTCGAGATACCCTGTTTCTCAAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125424    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028028.2-2247s1c1
Sequence:CCGGGCTCAACTTCTGATTGTATTTCTCGAGAAATACAATCAGAAGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028028.2-711s21c1
Sequence:CCGGACCTATGCTGCACCAGATTAGCTCGAGCTAATCTGGTGCAGCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323861    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028028.2-2247s21c1
Sequence:CCGGGCTCAACTTCTGATTGTATTTCTCGAGAAATACAATCAGAAGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028028.2-1993s21c1
Sequence:CCGGGACAACTGGATCGGCCCTTATCTCGAGATAAGGGCCGATCCAGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028028.2-1095s21c1
Sequence:CCGGCAAGTTCCTCCAGGGTAAATTCTCGAGAATTTACCCTGGAGGAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028028.2-1208s21c1
Sequence:CCGGAGCTGTACACGCTCCTGAATACTCGAGTATTCAGGAGCGTGTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028028
VALIDATED
ZSWIM1 MISSION shRNA Lentiviral Transduction Particles
zinc finger, SWIM-type containing 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028028.2-790s1c1
Sequence:CCGGGCTCATTTCCCTGAGGTCTTACTCGAGTAAGACCTCAGGGAAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028028.2-905s1c1
Sequence:CCGGCTGTGTACTTTGCCATCCCTACTCGAGTAGGGATGGCAAAGTACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028028.2-777s1c1
Sequence:CCGGGCAAGACCTCTTTGCTCATTTCTCGAGAAATGAGCAAAGAGGTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028028.2-1389s1c1
Sequence:CCGGCCCATTTGAGAAACAGGGTATCTCGAGATACCCTGTTTCTCAAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125424    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028028.2-2247s1c1
Sequence:CCGGGCTCAACTTCTGATTGTATTTCTCGAGAAATACAATCAGAAGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028028.2-711s21c1
Sequence:CCGGACCTATGCTGCACCAGATTAGCTCGAGCTAATCTGGTGCAGCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323861    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028028.2-2247s21c1
Sequence:CCGGGCTCAACTTCTGATTGTATTTCTCGAGAAATACAATCAGAAGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028028.2-1993s21c1
Sequence:CCGGGACAACTGGATCGGCCCTTATCTCGAGATAAGGGCCGATCCAGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028028.2-1095s21c1
Sequence:CCGGCAAGTTCCTCCAGGGTAAATTCTCGAGAATTTACCCTGGAGGAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028028.2-1208s21c1
Sequence:CCGGAGCTGTACACGCTCCTGAATACTCGAGTATTCAGGAGCGTGTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks