EMAIL THIS PAGE TO A FRIEND

ZSWIM2

zinc finger, SWIM-type containing 2

Synonyms: MEX ZZZ2
UniProtKB ID: Q8NEG5, B3KXV6, Q53SI3, Q57ZY3
Gene ID:
Mouse(71861) zinc finger SWIM-type containing 2
Rat(296455) zinc finger, SWIM-type containing 2
dog(478832) zinc finger, SWIM-type containing 2
domestic cat(101086080) zinc finger, SWIM-type containing 2
cow(517320) zinc finger, SWIM-type containing 2
sheep(101115760) zinc finger, SWIM-type containing 2
domestic guinea pig(100736068) zinc finger, SWIM-type containing 2
naked mole-rat(101712057) zinc finger, SWIM-type containing 2
84 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027964 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027964 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027964 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_182521 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182521 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182521 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182521 Rosetta Predictions human pricing
NM_001011960 Rosetta Predictions rat pricing
NM_027964 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182521 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00370610 predicted 424
2 SASI_Hs01_00165983 predicted 1733
3 SASI_Hs01_00165985 predicted 1064
4 SASI_Hs01_00165986 predicted 768
5 SASI_Hs01_00165987 predicted 1359
6 SASI_Hs01_00165988 predicted 1195
7 SASI_Hs02_00370611 predicted 1131
8 SASI_Hs02_00370612 predicted 1436
9 SASI_Hs01_00165990 predicted 1392
10 SASI_Hs01_00165991 predicted 585
11 SASI_Hs01_00165984 predicted 1291
12 SASI_Hs01_00165989 predicted 1278
13 SASI_Hs01_00165992 predicted 1158
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011960 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00055278 predicted 1783
2 SASI_Rn01_00055279 predicted 1800
3 SASI_Rn01_00055280 predicted 265
4 SASI_Rn01_00055281 predicted 1181
5 SASI_Rn01_00055282 predicted 1690
6 SASI_Rn01_00055283 predicted 526
7 SASI_Rn01_00055284 predicted 386
8 SASI_Rn02_00199978 predicted 1584
9 SASI_Rn01_00055285 predicted 1144
10 SASI_Rn02_00199979 predicted 1669
11 SASI_Rn01_00055276 predicted 683
12 SASI_Rn01_00055277 predicted 1739
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027964 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00056066 predicted 1194
2 SASI_Mm01_00056067 predicted 551
3 SASI_Mm01_00056068 predicted 612
4 SASI_Mm01_00056069 predicted 1678
5 SASI_Mm01_00056070 predicted 1419
6 SASI_Mm01_00056071 predicted 269
7 SASI_Mm01_00056072 predicted 1596
8 SASI_Mm01_00056073 predicted 810
9 SASI_Mm01_00056074 predicted 431
10 SASI_Mm01_00056075 predicted 1648
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027964
ZSWIM2 MISSION shRNA Bacterial Glycerol Stock
zinc finger, SWIM-type containing 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000448118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027964.2-1713s21c1
Sequence:CCGGATCTCTTGGTTCTAGATTAAGCTCGAGCTTAATCTAGAACCAAGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000444325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027964.2-1424s21c1
Sequence:CCGGCAGACAACTATCAGAATATAACTCGAGTTATATTCTGATAGTTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027964.1-1195s1c1
Sequence:CCGGCCCGATTGACAGACAAGTCATCTCGAGATGACTTGTCTGTCAATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027964.1-1677s1c1
Sequence:CCGGGCAGAGGTTACGAACATATAACTCGAGTTATATGTTCGTAACCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027964.1-1082s1c1
Sequence:CCGGCGACTTTGCTTGAAATCATTTCTCGAGAAATGATTTCAAGCAAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027964.1-552s1c1
Sequence:CCGGGTGGCAATAATGTTCACATAACTCGAGTTATGTGAACATTATTGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027964.1-1453s1c1
Sequence:CCGGCGACCTATGCTCAGTCAAATTCTCGAGAATTTGACTGAGCATAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027964
ZSWIM2 MISSION shRNA shRNA Plasmid DNA
zinc finger, SWIM-type containing 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000448118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027964.2-1713s21c1
Sequence:CCGGATCTCTTGGTTCTAGATTAAGCTCGAGCTTAATCTAGAACCAAGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000444325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027964.2-1424s21c1
Sequence:CCGGCAGACAACTATCAGAATATAACTCGAGTTATATTCTGATAGTTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027964.1-1195s1c1
Sequence:CCGGCCCGATTGACAGACAAGTCATCTCGAGATGACTTGTCTGTCAATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027964.1-1677s1c1
Sequence:CCGGGCAGAGGTTACGAACATATAACTCGAGTTATATGTTCGTAACCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027964.1-1082s1c1
Sequence:CCGGCGACTTTGCTTGAAATCATTTCTCGAGAAATGATTTCAAGCAAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027964.1-552s1c1
Sequence:CCGGGTGGCAATAATGTTCACATAACTCGAGTTATGTGAACATTATTGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027964.1-1453s1c1
Sequence:CCGGCGACCTATGCTCAGTCAAATTCTCGAGAATTTGACTGAGCATAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027964
ZSWIM2 MISSION shRNA Lentiviral Transduction Particles
zinc finger, SWIM-type containing 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000448118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027964.2-1713s21c1
Sequence:CCGGATCTCTTGGTTCTAGATTAAGCTCGAGCTTAATCTAGAACCAAGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000444325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027964.2-1424s21c1
Sequence:CCGGCAGACAACTATCAGAATATAACTCGAGTTATATTCTGATAGTTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027964.1-1195s1c1
Sequence:CCGGCCCGATTGACAGACAAGTCATCTCGAGATGACTTGTCTGTCAATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027964.1-1677s1c1
Sequence:CCGGGCAGAGGTTACGAACATATAACTCGAGTTATATGTTCGTAACCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027964.1-1082s1c1
Sequence:CCGGCGACTTTGCTTGAAATCATTTCTCGAGAAATGATTTCAAGCAAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027964.1-552s1c1
Sequence:CCGGGTGGCAATAATGTTCACATAACTCGAGTTATGTGAACATTATTGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027964.1-1453s1c1
Sequence:CCGGCGACCTATGCTCAGTCAAATTCTCGAGAATTTGACTGAGCATAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182521
ZSWIM2 MISSION shRNA Bacterial Glycerol Stock
zinc finger, SWIM-type containing 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000420081    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182521.2-2053s21c1
Sequence:CCGGATTTGCCTACTTACCTATAAACTCGAGTTTATAGGTAAGTAGGCAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182521.2-568s21c1
Sequence:CCGGCATGAAGATCTTAGCTAATTACTCGAGTAATTAGCTAAGATCTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182521.2-634s21c1
Sequence:CCGGGAAAGAGTTTGCACCATTAAACTCGAGTTTAATGGTGCAAACTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007820    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182521.1-1962s1c1
Sequence:CCGGTATTTGAATGTTGAATATAAACTCGAGTTTATATTCAACATTCAAATATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182521.1-1519s1c1
Sequence:CCGGCCCAGGTATCTTCAAGATTTACTCGAGTAAATCTTGAAGATACCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182521.1-1759s1c1
Sequence:CCGGCCAGAGGATTTCAATCTTATTCTCGAGAATAAGATTGAAATCCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182521.1-1116s1c1
Sequence:CCGGGCTACCATGTACTCACAAGTTCTCGAGAACTTGTGAGTACATGGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182521.1-400s1c1
Sequence:CCGGCCAGGAACAAATGACGAGAATCTCGAGATTCTCGTCATTTGTTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182521
ZSWIM2 MISSION shRNA shRNA Plasmid DNA
zinc finger, SWIM-type containing 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000420081    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182521.2-2053s21c1
Sequence:CCGGATTTGCCTACTTACCTATAAACTCGAGTTTATAGGTAAGTAGGCAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182521.2-568s21c1
Sequence:CCGGCATGAAGATCTTAGCTAATTACTCGAGTAATTAGCTAAGATCTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182521.2-634s21c1
Sequence:CCGGGAAAGAGTTTGCACCATTAAACTCGAGTTTAATGGTGCAAACTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007820    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182521.1-1962s1c1
Sequence:CCGGTATTTGAATGTTGAATATAAACTCGAGTTTATATTCAACATTCAAATATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182521.1-1519s1c1
Sequence:CCGGCCCAGGTATCTTCAAGATTTACTCGAGTAAATCTTGAAGATACCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182521.1-1759s1c1
Sequence:CCGGCCAGAGGATTTCAATCTTATTCTCGAGAATAAGATTGAAATCCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182521.1-1116s1c1
Sequence:CCGGGCTACCATGTACTCACAAGTTCTCGAGAACTTGTGAGTACATGGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182521.1-400s1c1
Sequence:CCGGCCAGGAACAAATGACGAGAATCTCGAGATTCTCGTCATTTGTTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182521
ZSWIM2 MISSION shRNA Lentiviral Transduction Particles
zinc finger, SWIM-type containing 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000420081    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182521.2-2053s21c1
Sequence:CCGGATTTGCCTACTTACCTATAAACTCGAGTTTATAGGTAAGTAGGCAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182521.2-568s21c1
Sequence:CCGGCATGAAGATCTTAGCTAATTACTCGAGTAATTAGCTAAGATCTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182521.2-634s21c1
Sequence:CCGGGAAAGAGTTTGCACCATTAAACTCGAGTTTAATGGTGCAAACTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007820    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182521.1-1962s1c1
Sequence:CCGGTATTTGAATGTTGAATATAAACTCGAGTTTATATTCAACATTCAAATATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182521.1-1519s1c1
Sequence:CCGGCCCAGGTATCTTCAAGATTTACTCGAGTAAATCTTGAAGATACCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182521.1-1759s1c1
Sequence:CCGGCCAGAGGATTTCAATCTTATTCTCGAGAATAAGATTGAAATCCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182521.1-1116s1c1
Sequence:CCGGGCTACCATGTACTCACAAGTTCTCGAGAACTTGTGAGTACATGGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182521.1-400s1c1
Sequence:CCGGCCAGGAACAAATGACGAGAATCTCGAGATTCTCGTCATTTGTTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks