EMAIL THIS PAGE TO A FRIEND

ZSWIM3

zinc finger, SWIM-type containing 3

Synonyms: C20orf164
UniProtKB ID: Q96MP5, Q9BR13
Gene ID:
Mouse(67538) zinc finger SWIM-type containing 3
Rat(311630) zinc finger, SWIM-type containing 3
naked mole-rat(101721654) zinc finger, SWIM-type containing 3
domestic guinea pig(100719405) zinc finger, SWIM-type containing 3
cow(512244) zinc finger, SWIM-type containing 3
cow(101904635) zinc finger, SWIM-type containing 3
sheep(101113090) zinc finger, SWIM-type containing 3
chicken(428161) zinc finger, SWIM-type containing 3
dog(485901) zinc finger, SWIM-type containing 3
Horse(100056419) zinc finger, SWIM-type containing 3
domestic cat(101085875) zinc finger, SWIM-type containing 3
72 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080752 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080752 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080752 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178375 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178375 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178375 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080752 Rosetta Predictions human pricing
NM_001107801 Rosetta Predictions rat pricing
NM_178375 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080752 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096994 predicted 2272
2 SASI_Hs01_00096995 predicted 2356
3 SASI_Hs02_00362550 predicted 1149
4 SASI_Hs02_00362551 predicted 2338
5 SASI_Hs01_00096997 predicted 2310
6 SASI_Hs01_00096998 predicted 2043
7 SASI_Hs01_00096999 predicted 226
8 SASI_Hs01_00097000 predicted 348
9 SASI_Hs01_00097001 predicted 438
10 SASI_Hs01_00097002 predicted 813
11 SASI_Hs01_00096996 predicted 454
12 SASI_Hs01_00097003 predicted 2035
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107801 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232405 predicted 1430
2 SASI_Rn02_00232406 predicted 2025
3 SASI_Rn02_00232407 predicted 2277
4 SASI_Rn02_00232408 predicted 2299
5 SASI_Rn02_00232409 predicted 434
6 SASI_Rn02_00232410 predicted 1690
7 SASI_Rn02_00232411 predicted 684
8 SASI_Rn02_00232412 predicted 1128
9 SASI_Rn02_00232413 predicted 2271
10 SASI_Rn02_00232414 predicted 987
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178375 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00348773 predicted 1412
2 SASI_Mm01_00127067 predicted 438
3 SASI_Mm01_00127068 predicted 428
4 SASI_Mm01_00127069 predicted 493
5 SASI_Mm01_00127070 predicted 1677
6 SASI_Mm01_00127072 predicted 1105
7 SASI_Mm01_00127073 predicted 1096
8 SASI_Mm01_00127074 predicted 1318
9 SASI_Mm01_00127075 predicted 2242
10 SASI_Mm01_00127076 predicted 1712
11 SASI_Mm01_00127071 predicted 333
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080752
ZSWIM3 MISSION shRNA Bacterial Glycerol Stock
zinc finger, SWIM-type containing 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164194    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080752.1-831s1c1
Sequence:CCGGCAGTAAGATGACCGACCTGTTCTCGAGAACAGGTCGGTCATCTTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159536    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080752.1-1860s1c1
Sequence:CCGGCTGTTCCTTTCAACAATGGTACTCGAGTACCATTGTTGAAAGGAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159958    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080752.1-1468s1c1
Sequence:CCGGGTGGATTACATAGACTTCTTTCTCGAGAAAGAAGTCTATGTAATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160856    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080752.1-372s1c1
Sequence:CCGGGCAGGTGAAATTTGTCTGCATCTCGAGATGCAGACAAATTTCACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161968    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080752.1-507s1c1
Sequence:CCGGGCACATACATGGTGACTCTAACTCGAGTTAGAGTCACCATGTATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080752.1-1067s1c1
Sequence:CCGGCTTCATTCCATTACCGGGCTACTCGAGTAGCCCGGTAATGGAATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163853    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080752.1-1392s1c1
Sequence:CCGGCCTAGACATTGTCACCAGCAACTCGAGTTGCTGGTGACAATGTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164095    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080752.1-2047s1c1
Sequence:CCGGCAAGGACGGAACGACATGATTCTCGAGAATCATGTCGTTCCGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163763    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080752.1-1365s1c1
Sequence:CCGGGCTTGCGTGTAACACCTACATCTCGAGATGTAGGTGTTACACGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080752
ZSWIM3 MISSION shRNA shRNA Plasmid DNA
zinc finger, SWIM-type containing 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164194    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080752.1-831s1c1
Sequence:CCGGCAGTAAGATGACCGACCTGTTCTCGAGAACAGGTCGGTCATCTTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159536    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080752.1-1860s1c1
Sequence:CCGGCTGTTCCTTTCAACAATGGTACTCGAGTACCATTGTTGAAAGGAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159958    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080752.1-1468s1c1
Sequence:CCGGGTGGATTACATAGACTTCTTTCTCGAGAAAGAAGTCTATGTAATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160856    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080752.1-372s1c1
Sequence:CCGGGCAGGTGAAATTTGTCTGCATCTCGAGATGCAGACAAATTTCACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161968    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080752.1-507s1c1
Sequence:CCGGGCACATACATGGTGACTCTAACTCGAGTTAGAGTCACCATGTATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080752.1-1067s1c1
Sequence:CCGGCTTCATTCCATTACCGGGCTACTCGAGTAGCCCGGTAATGGAATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163853    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080752.1-1392s1c1
Sequence:CCGGCCTAGACATTGTCACCAGCAACTCGAGTTGCTGGTGACAATGTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164095    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080752.1-2047s1c1
Sequence:CCGGCAAGGACGGAACGACATGATTCTCGAGAATCATGTCGTTCCGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163763    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080752.1-1365s1c1
Sequence:CCGGGCTTGCGTGTAACACCTACATCTCGAGATGTAGGTGTTACACGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080752
ZSWIM3 MISSION shRNA Lentiviral Transduction Particles
zinc finger, SWIM-type containing 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164194    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080752.1-831s1c1
Sequence:CCGGCAGTAAGATGACCGACCTGTTCTCGAGAACAGGTCGGTCATCTTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159536    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080752.1-1860s1c1
Sequence:CCGGCTGTTCCTTTCAACAATGGTACTCGAGTACCATTGTTGAAAGGAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159958    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080752.1-1468s1c1
Sequence:CCGGGTGGATTACATAGACTTCTTTCTCGAGAAAGAAGTCTATGTAATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160856    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080752.1-372s1c1
Sequence:CCGGGCAGGTGAAATTTGTCTGCATCTCGAGATGCAGACAAATTTCACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161968    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080752.1-507s1c1
Sequence:CCGGGCACATACATGGTGACTCTAACTCGAGTTAGAGTCACCATGTATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080752.1-1067s1c1
Sequence:CCGGCTTCATTCCATTACCGGGCTACTCGAGTAGCCCGGTAATGGAATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163853    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080752.1-1392s1c1
Sequence:CCGGCCTAGACATTGTCACCAGCAACTCGAGTTGCTGGTGACAATGTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164095    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080752.1-2047s1c1
Sequence:CCGGCAAGGACGGAACGACATGATTCTCGAGAATCATGTCGTTCCGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163763    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080752.1-1365s1c1
Sequence:CCGGGCTTGCGTGTAACACCTACATCTCGAGATGTAGGTGTTACACGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178375
ZSWIM3 MISSION shRNA Bacterial Glycerol Stock
zinc finger, SWIM-type containing 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178375.2-1309s1c1
Sequence:CCGGGCATGCATGTAACACCTACATCTCGAGATGTAGGTGTTACATGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200863    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178375.2-2469s1c1
Sequence:CCGGGCCAAAGTTATTCCATATGAACTCGAGTTCATATGGAATAACTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178375.2-1408s1c1
Sequence:CCGGCTTTGTGGATTACATAGACTTCTCGAGAAGTCTATGTAATCCACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178375.2-1402s1c1
Sequence:CCGGCCTTCACTTTGTGGATTACATCTCGAGATGTAATCCACAAAGTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178375.2-193s1c1
Sequence:CCGGCGAGGACTTCAAGGAGTGTTTCTCGAGAAACACTCCTTGAAGTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178375
ZSWIM3 MISSION shRNA shRNA Plasmid DNA
zinc finger, SWIM-type containing 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178375.2-1309s1c1
Sequence:CCGGGCATGCATGTAACACCTACATCTCGAGATGTAGGTGTTACATGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200863    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178375.2-2469s1c1
Sequence:CCGGGCCAAAGTTATTCCATATGAACTCGAGTTCATATGGAATAACTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178375.2-1408s1c1
Sequence:CCGGCTTTGTGGATTACATAGACTTCTCGAGAAGTCTATGTAATCCACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178375.2-1402s1c1
Sequence:CCGGCCTTCACTTTGTGGATTACATCTCGAGATGTAATCCACAAAGTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178375.2-193s1c1
Sequence:CCGGCGAGGACTTCAAGGAGTGTTTCTCGAGAAACACTCCTTGAAGTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178375
ZSWIM3 MISSION shRNA Lentiviral Transduction Particles
zinc finger, SWIM-type containing 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178375.2-1309s1c1
Sequence:CCGGGCATGCATGTAACACCTACATCTCGAGATGTAGGTGTTACATGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200863    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178375.2-2469s1c1
Sequence:CCGGGCCAAAGTTATTCCATATGAACTCGAGTTCATATGGAATAACTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178375.2-1408s1c1
Sequence:CCGGCTTTGTGGATTACATAGACTTCTCGAGAAGTCTATGTAATCCACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178375.2-1402s1c1
Sequence:CCGGCCTTCACTTTGTGGATTACATCTCGAGATGTAATCCACAAAGTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178375.2-193s1c1
Sequence:CCGGCGAGGACTTCAAGGAGTGTTTCTCGAGAAACACTCCTTGAAGTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks