EMAIL THIS PAGE TO A FRIEND

ZSWIM4

zinc finger, SWIM-type containing 4

UniProtKB ID: Q9H7M6
Gene ID:
Mouse(212168) zinc finger SWIM-type containing 4
Rat(304655) zinc finger, SWIM-type containing 4
domestic cat(101095319) zinc finger, SWIM-type containing 4
dog(484913) zinc finger, SWIM-type containing 4
cow(781514) zinc finger, SWIM-type containing 4
sheep(101102478) zinc finger, SWIM-type containing 4
domestic guinea pig(100725191) zinc finger, SWIM-type containing 4
naked mole-rat(101699362) zinc finger, SWIM-type containing 4
44 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172503 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172503 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172503 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_023072 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_023072 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_023072 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU004041 MISSION® esiRNA esiRNA targeting human ZSWIM4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_023072 Rosetta Predictions human pricing
NM_001107163 Rosetta Predictions rat pricing
NM_172503 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023072 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00356309 predicted 799
2 SASI_Hs01_00246542 predicted 653
3 SASI_Hs01_00246543 predicted 538
4 SASI_Hs01_00246544 predicted 2982
5 SASI_Hs01_00246545 predicted 1268
6 SASI_Hs01_00246547 predicted 3245
7 SASI_Hs01_00246548 predicted 1882
8 SASI_Hs01_00246549 predicted 2828
9 SASI_Hs02_00356310 predicted 2947
10 SASI_Hs01_00246550 predicted 3219
11 SASI_Hs01_00246541 predicted 1494
12 SASI_Hs01_00246546 predicted 2473
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107163 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226125 predicted 1146
2 SASI_Rn02_00226126 predicted 3171
3 SASI_Rn02_00226127 predicted 1343
4 SASI_Rn02_00226128 predicted 2859
5 SASI_Rn02_00226129 predicted 2972
6 SASI_Rn02_00226130 predicted 2957
7 SASI_Rn02_00226131 predicted 2499
8 SASI_Rn02_00226132 predicted 1831
9 SASI_Rn02_00226133 predicted 2868
10 SASI_Rn02_00226134 predicted 2166
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172503 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00075421 predicted 3402
2 SASI_Mm01_00075422 predicted 2859
3 SASI_Mm02_00344089 predicted 212
4 SASI_Mm01_00075423 predicted 3167
5 SASI_Mm01_00075425 predicted 1097
6 SASI_Mm01_00075426 predicted 1142
7 SASI_Mm01_00075427 predicted 771
8 SASI_Mm01_00075428 predicted 1832
9 SASI_Mm01_00075429 predicted 2962
10 SASI_Mm02_00344090 predicted 824
11 SASI_Mm01_00075424 predicted 643
12 SASI_Mm01_00075430 predicted 1408
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172503
VALIDATED
ZSWIM4 MISSION shRNA Bacterial Glycerol Stock
zinc finger, SWIM-type containing 4
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000199003    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172503.2-3702s1c1
Sequence:CCGGGCACTTCACATCAGGGTAGTTCTCGAGAACTACCCTGATGTGAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172503.2-2510s1c1
Sequence:CCGGGAAGAACTGGTACTCCTTGTTCTCGAGAACAAGGAGTACCAGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172503.2-1850s1c1
Sequence:CCGGGCGCAATGAAGAACAGCTACTCTCGAGAGTAGCTGTTCTTCATTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172503.2-2507s1c1
Sequence:CCGGCATGAAGAACTGGTACTCCTTCTCGAGAAGGAGTACCAGTTCTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172503
VALIDATED
ZSWIM4 MISSION shRNA shRNA Plasmid DNA
zinc finger, SWIM-type containing 4
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000199003    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172503.2-3702s1c1
Sequence:CCGGGCACTTCACATCAGGGTAGTTCTCGAGAACTACCCTGATGTGAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172503.2-2510s1c1
Sequence:CCGGGAAGAACTGGTACTCCTTGTTCTCGAGAACAAGGAGTACCAGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172503.2-1850s1c1
Sequence:CCGGGCGCAATGAAGAACAGCTACTCTCGAGAGTAGCTGTTCTTCATTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172503.2-2507s1c1
Sequence:CCGGCATGAAGAACTGGTACTCCTTCTCGAGAAGGAGTACCAGTTCTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172503
VALIDATED
ZSWIM4 MISSION shRNA Lentiviral Transduction Particles
zinc finger, SWIM-type containing 4
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000199003    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172503.2-3702s1c1
Sequence:CCGGGCACTTCACATCAGGGTAGTTCTCGAGAACTACCCTGATGTGAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172503.2-2510s1c1
Sequence:CCGGGAAGAACTGGTACTCCTTGTTCTCGAGAACAAGGAGTACCAGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172503.2-1850s1c1
Sequence:CCGGGCGCAATGAAGAACAGCTACTCTCGAGAGTAGCTGTTCTTCATTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172503.2-2507s1c1
Sequence:CCGGCATGAAGAACTGGTACTCCTTCTCGAGAAGGAGTACCAGTTCTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023072
ZSWIM4 MISSION shRNA Bacterial Glycerol Stock
zinc finger, SWIM-type containing 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023072.1-2304s1c1
Sequence:CCGGGCAAGCCCTGATGAATATCATCTCGAGATGATATTCATCAGGGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023072.1-3075s1c1
Sequence:CCGGGTTCTCACAGTTCTTGGAGAACTCGAGTTCTCCAAGAACTGTGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149144    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023072.1-3922s1c1
Sequence:CCGGGAGACCTGTATCTTGGTGTTTCTCGAGAAACACCAAGATACAGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023072.1-3116s1c1
Sequence:CCGGGCAAGAAGAAACTCATGCTTTCTCGAGAAAGCATGAGTTTCTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023072.1-2817s1c1
Sequence:CCGGCCCAATGCTGTCCGATATTCTCTCGAGAGAATATCGGACAGCATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130420    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023072.1-3093s1c1
Sequence:CCGGGAACCTCAAACAGACCTACAACTCGAGTTGTAGGTCTGTTTGAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023072.2-881s21c1
Sequence:CCGGCCGAGATCAACTTGGTGAATGCTCGAGCATTCACCAAGTTGATCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023072.2-406s21c1
Sequence:CCGGCCACGCAGTGAACGGGAAATACTCGAGTATTTCCCGTTCACTGCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023072.2-2223s21c1
Sequence:CCGGGCGGATGACTCTGAACGTAATCTCGAGATTACGTTCAGAGTCATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436005    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023072.2-3521s21c1
Sequence:CCGGCTAAGTCAATGTAGCACATTTCTCGAGAAATGTGCTACATTGACTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023072
ZSWIM4 MISSION shRNA shRNA Plasmid DNA
zinc finger, SWIM-type containing 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023072.1-2304s1c1
Sequence:CCGGGCAAGCCCTGATGAATATCATCTCGAGATGATATTCATCAGGGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023072.1-3075s1c1
Sequence:CCGGGTTCTCACAGTTCTTGGAGAACTCGAGTTCTCCAAGAACTGTGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149144    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023072.1-3922s1c1
Sequence:CCGGGAGACCTGTATCTTGGTGTTTCTCGAGAAACACCAAGATACAGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023072.1-3116s1c1
Sequence:CCGGGCAAGAAGAAACTCATGCTTTCTCGAGAAAGCATGAGTTTCTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023072.1-2817s1c1
Sequence:CCGGCCCAATGCTGTCCGATATTCTCTCGAGAGAATATCGGACAGCATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130420    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023072.1-3093s1c1
Sequence:CCGGGAACCTCAAACAGACCTACAACTCGAGTTGTAGGTCTGTTTGAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023072.2-881s21c1
Sequence:CCGGCCGAGATCAACTTGGTGAATGCTCGAGCATTCACCAAGTTGATCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023072.2-406s21c1
Sequence:CCGGCCACGCAGTGAACGGGAAATACTCGAGTATTTCCCGTTCACTGCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023072.2-2223s21c1
Sequence:CCGGGCGGATGACTCTGAACGTAATCTCGAGATTACGTTCAGAGTCATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436005    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023072.2-3521s21c1
Sequence:CCGGCTAAGTCAATGTAGCACATTTCTCGAGAAATGTGCTACATTGACTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023072
ZSWIM4 MISSION shRNA Lentiviral Transduction Particles
zinc finger, SWIM-type containing 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023072.1-2304s1c1
Sequence:CCGGGCAAGCCCTGATGAATATCATCTCGAGATGATATTCATCAGGGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023072.1-3075s1c1
Sequence:CCGGGTTCTCACAGTTCTTGGAGAACTCGAGTTCTCCAAGAACTGTGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149144    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023072.1-3922s1c1
Sequence:CCGGGAGACCTGTATCTTGGTGTTTCTCGAGAAACACCAAGATACAGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023072.1-3116s1c1
Sequence:CCGGGCAAGAAGAAACTCATGCTTTCTCGAGAAAGCATGAGTTTCTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023072.1-2817s1c1
Sequence:CCGGCCCAATGCTGTCCGATATTCTCTCGAGAGAATATCGGACAGCATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130420    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023072.1-3093s1c1
Sequence:CCGGGAACCTCAAACAGACCTACAACTCGAGTTGTAGGTCTGTTTGAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023072.2-881s21c1
Sequence:CCGGCCGAGATCAACTTGGTGAATGCTCGAGCATTCACCAAGTTGATCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023072.2-406s21c1
Sequence:CCGGCCACGCAGTGAACGGGAAATACTCGAGTATTTCCCGTTCACTGCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023072.2-2223s21c1
Sequence:CCGGGCGGATGACTCTGAACGTAATCTCGAGATTACGTTCAGAGTCATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436005    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023072.2-3521s21c1
Sequence:CCGGCTAAGTCAATGTAGCACATTTCTCGAGAAATGTGCTACATTGACTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks