EMAIL THIS PAGE TO A FRIEND

ZSWIM5

zinc finger, SWIM-type containing 5

UniProtKB ID: Q9P217, Q5SXQ9
Gene ID:
Mouse(74464) zinc finger SWIM-type containing 5
Rat(313524) zinc finger, SWIM-type containing 5
domestic guinea pig(100727724) zinc finger, SWIM-type containing 5
cow(540778) zinc finger, SWIM-type containing 5
sheep(101110809) zinc finger, SWIM-type containing 5
Zebrafish(100149522) zinc finger, SWIM-type containing 5
Horse(100065603) zinc finger, SWIM-type containing 5
domestic cat(101101653) zinc finger, SWIM-type containing 5
dog(610608) zinc finger, SWIM-type containing 5
chicken(424591) zinc finger, SWIM-type containing 5
153 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001029912 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001029912 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001029912 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020883 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020883 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020883 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU162691 MISSION® esiRNA esiRNA targeting mouse Zswim5 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020883 Rosetta Predictions human pricing
XM_046581 Rosetta Predictions human pricing
NM_001107963 Rosetta Predictions rat pricing
NM_001029912 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020883 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354184 predicted 979
2 SASI_Hs02_00354185 predicted 2686
3 SASI_Hs02_00354186 predicted 1214
4 SASI_Hs02_00354187 predicted 1477
5 SASI_Hs02_00354188 predicted 2670
6 SASI_Hs02_00354189 predicted 1306
7 SASI_Hs02_00354190 predicted 3265
8 SASI_Hs02_00354191 predicted 1707
9 SASI_Hs02_00354192 predicted 3612
10 SASI_Hs02_00354193 predicted 1740
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_046581 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00279682 predicted 2247
2 SASI_Hs01_00279683 predicted 1476
3 SASI_Hs01_00279684 predicted 1712
4 SASI_Hs01_00279685 predicted 1976
5 SASI_Hs01_00279686 predicted 3178
6 SASI_Hs01_00279687 predicted 1887
7 SASI_Hs01_00279688 predicted 4111
8 SASI_Hs01_00279689 predicted 2237
9 SASI_Hs01_00279690 predicted 3328
10 SASI_Hs01_00279691 predicted 1490
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107963 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234015 predicted 2358
2 SASI_Rn02_00234016 predicted 1191
3 SASI_Rn02_00234017 predicted 981
4 SASI_Rn02_00234018 predicted 1992
5 SASI_Rn02_00234019 predicted 452
6 SASI_Rn02_00234020 predicted 2043
7 SASI_Rn02_00234021 predicted 1033
8 SASI_Rn02_00234022 predicted 2067
9 SASI_Rn02_00234023 predicted 452
10 SASI_Rn02_00234024 predicted 605
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029912 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00288051 predicted 2962
2 SASI_Mm02_00288052 predicted 1206
3 SASI_Mm01_00112950 predicted 1313
4 SASI_Mm01_00112951 predicted 3122
5 SASI_Mm01_00112952 predicted 2054
6 SASI_Mm01_00112953 predicted 2534
7 SASI_Mm01_00112954 predicted 3458
8 SASI_Mm01_00112956 predicted 3706
9 SASI_Mm01_00112957 predicted 1227
10 SASI_Mm01_00112959 predicted 901
11 SASI_Mm01_00112955 predicted 1120
12 SASI_Mm01_00112958 predicted 839
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001029912
ZSWIM5 MISSION shRNA Bacterial Glycerol Stock
zinc finger, SWIM-type containing 5
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029912.2-1587s21c1
Sequence:CCGGTAATCAGCAGTGGGATCTATACTCGAGTATAGATCCCACTGCTGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029912.2-2813s21c1
Sequence:CCGGCCGACTGAGGCTACAAGTATTCTCGAGAATACTTGTAGCCTCAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216578    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001029912.2-4532s1c1
Sequence:CCGGGTGTTAGACTGGGTTTCATTTCTCGAGAAATGAAACCCAGTCTAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029912.2-1746s21c1
Sequence:CCGGGACTCACGGTGGCCATCATTACTCGAGTAATGATGGCCACCGTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251753    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001029912.2-5183s21c1
Sequence:CCGGTACAGGTGTCTTCGGTGTTTACTCGAGTAAACACCGAAGACACCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029912.2-2193s21c1
Sequence:CCGGTGCGCAAACAGTGCATCTTACCTCGAGGTAAGATGCACTGTTTGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201873    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029912.1-1714s1c1
Sequence:CCGGGCGATCTCATGGGTATCCAAACTCGAGTTTGGATACCCATGAGATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200698    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029912.1-2972s1c1
Sequence:CCGGGCTCTTACACTTTGTGAGAAACTCGAGTTTCTCACAAAGTGTAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029912.1-2534s1c1
Sequence:CCGGCGAACTCTTCTGGAAGCGATACTCGAGTATCGCTTCCAGAAGAGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001029912
ZSWIM5 MISSION shRNA shRNA Plasmid DNA
zinc finger, SWIM-type containing 5
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029912.2-1587s21c1
Sequence:CCGGTAATCAGCAGTGGGATCTATACTCGAGTATAGATCCCACTGCTGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029912.2-2813s21c1
Sequence:CCGGCCGACTGAGGCTACAAGTATTCTCGAGAATACTTGTAGCCTCAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216578    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001029912.2-4532s1c1
Sequence:CCGGGTGTTAGACTGGGTTTCATTTCTCGAGAAATGAAACCCAGTCTAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029912.2-1746s21c1
Sequence:CCGGGACTCACGGTGGCCATCATTACTCGAGTAATGATGGCCACCGTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251753    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001029912.2-5183s21c1
Sequence:CCGGTACAGGTGTCTTCGGTGTTTACTCGAGTAAACACCGAAGACACCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029912.2-2193s21c1
Sequence:CCGGTGCGCAAACAGTGCATCTTACCTCGAGGTAAGATGCACTGTTTGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201873    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029912.1-1714s1c1
Sequence:CCGGGCGATCTCATGGGTATCCAAACTCGAGTTTGGATACCCATGAGATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200698    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029912.1-2972s1c1
Sequence:CCGGGCTCTTACACTTTGTGAGAAACTCGAGTTTCTCACAAAGTGTAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029912.1-2534s1c1
Sequence:CCGGCGAACTCTTCTGGAAGCGATACTCGAGTATCGCTTCCAGAAGAGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001029912
ZSWIM5 MISSION shRNA Lentiviral Transduction Particles
zinc finger, SWIM-type containing 5
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029912.2-1587s21c1
Sequence:CCGGTAATCAGCAGTGGGATCTATACTCGAGTATAGATCCCACTGCTGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029912.2-2813s21c1
Sequence:CCGGCCGACTGAGGCTACAAGTATTCTCGAGAATACTTGTAGCCTCAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216578    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001029912.2-4532s1c1
Sequence:CCGGGTGTTAGACTGGGTTTCATTTCTCGAGAAATGAAACCCAGTCTAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029912.2-1746s21c1
Sequence:CCGGGACTCACGGTGGCCATCATTACTCGAGTAATGATGGCCACCGTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251753    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001029912.2-5183s21c1
Sequence:CCGGTACAGGTGTCTTCGGTGTTTACTCGAGTAAACACCGAAGACACCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029912.2-2193s21c1
Sequence:CCGGTGCGCAAACAGTGCATCTTACCTCGAGGTAAGATGCACTGTTTGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201873    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029912.1-1714s1c1
Sequence:CCGGGCGATCTCATGGGTATCCAAACTCGAGTTTGGATACCCATGAGATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200698    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029912.1-2972s1c1
Sequence:CCGGGCTCTTACACTTTGTGAGAAACTCGAGTTTCTCACAAAGTGTAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029912.1-2534s1c1
Sequence:CCGGCGAACTCTTCTGGAAGCGATACTCGAGTATCGCTTCCAGAAGAGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020883
ZSWIM5 MISSION shRNA Bacterial Glycerol Stock
zinc finger, SWIM-type containing 5
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020883.1-1907s21c1
Sequence:CCGGGACTCACAGTGGCCATTATTACTCGAGTAATAATGGCCACTGTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020883.1-1731s21c1
Sequence:CCGGTAGCCACCTACAGCGAATAATCTCGAGATTATTCGCTGTAGGTGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020883.1-2479s21c1
Sequence:CCGGGATCCAGACCTGTCCTATAAACTCGAGTTTATAGGACAGGTCTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020883.1-2436s21c1
Sequence:CCGGGCATACCTTTGCCAAGTATTTCTCGAGAAATACTTGGCAAAGGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245895    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020883.1-3932s21c1
Sequence:CCGGAGTCCAGCTCTAGTCGATAATCTCGAGATTATCGACTAGAGCTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020883
ZSWIM5 MISSION shRNA shRNA Plasmid DNA
zinc finger, SWIM-type containing 5
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020883.1-1907s21c1
Sequence:CCGGGACTCACAGTGGCCATTATTACTCGAGTAATAATGGCCACTGTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020883.1-1731s21c1
Sequence:CCGGTAGCCACCTACAGCGAATAATCTCGAGATTATTCGCTGTAGGTGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020883.1-2479s21c1
Sequence:CCGGGATCCAGACCTGTCCTATAAACTCGAGTTTATAGGACAGGTCTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020883.1-2436s21c1
Sequence:CCGGGCATACCTTTGCCAAGTATTTCTCGAGAAATACTTGGCAAAGGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245895    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020883.1-3932s21c1
Sequence:CCGGAGTCCAGCTCTAGTCGATAATCTCGAGATTATCGACTAGAGCTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020883
ZSWIM5 MISSION shRNA Lentiviral Transduction Particles
zinc finger, SWIM-type containing 5
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020883.1-1907s21c1
Sequence:CCGGGACTCACAGTGGCCATTATTACTCGAGTAATAATGGCCACTGTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020883.1-1731s21c1
Sequence:CCGGTAGCCACCTACAGCGAATAATCTCGAGATTATTCGCTGTAGGTGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020883.1-2479s21c1
Sequence:CCGGGATCCAGACCTGTCCTATAAACTCGAGTTTATAGGACAGGTCTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020883.1-2436s21c1
Sequence:CCGGGCATACCTTTGCCAAGTATTTCTCGAGAAATACTTGGCAAAGGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245895    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020883.1-3932s21c1
Sequence:CCGGAGTCCAGCTCTAGTCGATAATCTCGAGATTATCGACTAGAGCTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks