EMAIL THIS PAGE TO A FRIEND

ZSWIM6

zinc finger, SWIM-type containing 6

UniProtKB ID: Q9HCJ5
Gene ID:
Mouse(67263) zinc finger SWIM-type containing 6
Rat(310062) zinc finger, SWIM-type containing 6
Zebrafish(403057) zinc finger, SWIM-type containing 6
domestic cat(101100860) zinc finger, SWIM-type containing 6
dog(478068) zinc finger, SWIM-type containing 6
chicken(770670) zinc finger, SWIM-type containing 6
cow(538841) zinc finger, SWIM-type containing 6
sheep(101112003) zinc finger, SWIM-type containing 6
domestic guinea pig(100722775) zinc finger, SWIM-type containing 6
naked mole-rat(101704420) zinc finger, SWIM-type containing 6
203 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145456 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145456 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145456 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_001716154 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_001716154 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_001716154 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001716154 Rosetta Predictions human pricing
XM_035299 Rosetta Predictions human pricing
XM_936273 Rosetta Predictions human pricing
NM_001047884 Rosetta Predictions rat pricing
XM_358311 Rosetta Predictions mouse pricing
XM_905246 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001716154 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00408563 predicted 2112
2 SASI_Hs02_00408564 predicted 2053
3 SASI_Hs02_00408565 predicted 266
4 SASI_Hs02_00408566 predicted 1879
5 SASI_Hs02_00408567 predicted 421
6 SASI_Hs02_00408568 predicted 2256
7 SASI_Hs02_00408569 predicted 494
8 SASI_Hs02_00408570 predicted 1584
9 SASI_Hs02_00408571 predicted 580
10 SASI_Hs02_00408572 predicted 855
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_035299 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00264634 predicted 2744
2 SASI_Hs01_00264635 predicted 2690
3 SASI_Hs01_00264636 predicted 899
4 SASI_Hs01_00264637 predicted 2517
5 SASI_Hs01_00264638 predicted 1057
6 SASI_Hs01_00264639 predicted 2899
7 SASI_Hs01_00264640 predicted 1134
8 SASI_Hs02_00478649 predicted 2216
9 SASI_Hs01_00264642 predicted 1215
10 SASI_Hs01_00264643 predicted 1498
11 SASI_Hs01_00264641 predicted 2568
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_936273 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00481984 predicted 2105
2 SASI_Hs02_00481985 predicted 2046
3 SASI_Hs02_00481986 predicted 267
4 SASI_Hs02_00481987 predicted 1880
5 SASI_Hs02_00481988 predicted 423
6 SASI_Hs02_00481989 predicted 2260
7 SASI_Hs02_00481990 predicted 498
8 SASI_Hs02_00481991 predicted 1584
9 SASI_Hs02_00481992 predicted 575
10 SASI_Hs02_00481993 predicted 856
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047884 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00206477 predicted 231
2 SASI_Rn02_00206478 predicted 919
3 SASI_Rn02_00206479 predicted 1732
4 SASI_Rn02_00206480 predicted 1244
5 SASI_Rn02_00206481 predicted 1842
6 SASI_Rn02_00206482 predicted 991
7 SASI_Rn02_00206483 predicted 1943
8 SASI_Rn02_00206484 predicted 1252
9 SASI_Rn02_00206485 predicted 1292
10 SASI_Rn02_00206486 predicted 1240
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_358311 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00251511 predicted 2543
2 SASI_Mm01_00251512 predicted 2713
3 SASI_Mm01_00251513 predicted 3235
4 SASI_Mm01_00251514 predicted 3457
5 SASI_Mm01_00251515 predicted 3059
6 SASI_Mm01_00251516 predicted 3271
7 SASI_Mm01_00251518 predicted 2752
8 SASI_Mm01_00251519 predicted 3157
9 SASI_Mm01_00251520 predicted 3073
10 SASI_Mm02_00426239 predicted 2695
11 SASI_Mm01_00251517 predicted 3541
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_905246 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00431614 predicted 2283
2 SASI_Mm02_00431615 predicted 2807
3 SASI_Mm02_00431616 predicted 3031
4 SASI_Mm02_00431617 predicted 2842
5 SASI_Mm02_00431618 predicted 2330
6 SASI_Mm02_00431619 predicted 717
7 SASI_Mm02_00431620 predicted 419
8 SASI_Mm02_00431621 predicted 997
9 SASI_Mm02_00431622 predicted 549
10 SASI_Mm02_00431623 predicted 593
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145456
VALIDATED
ZSWIM6 MISSION shRNA Bacterial Glycerol Stock
zinc finger, SWIM-type containing 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000258245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145456.2-3293s21c1
Sequence:CCGGCAACGGTACTGTCGGACATTTCTCGAGAAATGTCCGACAGTACCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145456.2-3243s21c1
Sequence:CCGGGAATGAGCTAGCAGCTATAATCTCGAGATTATAGCTGCTAGCTCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145456.2-3476s21c1
Sequence:CCGGCTCGGCACTATAGCGAGTTTACTCGAGTAAACTCGCTATAGTGCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145456.2-2721s21c1
Sequence:CCGGCAATTGGCGACGTCGAGAAATCTCGAGATTTCTCGACGTCGCCAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252543    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145456.2-3764s21c1
Sequence:CCGGATTGCGTTTGCAGACTAAATTCTCGAGAATTTAGTCTGCAAACGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145456
VALIDATED
ZSWIM6 MISSION shRNA shRNA Plasmid DNA
zinc finger, SWIM-type containing 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000258245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145456.2-3293s21c1
Sequence:CCGGCAACGGTACTGTCGGACATTTCTCGAGAAATGTCCGACAGTACCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145456.2-3243s21c1
Sequence:CCGGGAATGAGCTAGCAGCTATAATCTCGAGATTATAGCTGCTAGCTCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145456.2-3476s21c1
Sequence:CCGGCTCGGCACTATAGCGAGTTTACTCGAGTAAACTCGCTATAGTGCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145456.2-2721s21c1
Sequence:CCGGCAATTGGCGACGTCGAGAAATCTCGAGATTTCTCGACGTCGCCAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252543    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145456.2-3764s21c1
Sequence:CCGGATTGCGTTTGCAGACTAAATTCTCGAGAATTTAGTCTGCAAACGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145456
VALIDATED
ZSWIM6 MISSION shRNA Lentiviral Transduction Particles
zinc finger, SWIM-type containing 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000258245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145456.2-3293s21c1
Sequence:CCGGCAACGGTACTGTCGGACATTTCTCGAGAAATGTCCGACAGTACCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145456.2-3243s21c1
Sequence:CCGGGAATGAGCTAGCAGCTATAATCTCGAGATTATAGCTGCTAGCTCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145456.2-3476s21c1
Sequence:CCGGCTCGGCACTATAGCGAGTTTACTCGAGTAAACTCGCTATAGTGCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145456.2-2721s21c1
Sequence:CCGGCAATTGGCGACGTCGAGAAATCTCGAGATTTCTCGACGTCGCCAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252543    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145456.2-3764s21c1
Sequence:CCGGATTGCGTTTGCAGACTAAATTCTCGAGAATTTAGTCTGCAAACGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001716154
VALIDATED
ZSWIM6 MISSION shRNA Bacterial Glycerol Stock
zinc finger, SWIM-type containing 6
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000236694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:XM_001716154.1-2466s21c1
Sequence:CCGGTACGACTGGCATGAGCTATACCTCGAGGTATAGCTCATGCCAGTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001716154.1-503s21c1
Sequence:CCGGAGGTTCAAGAACAGGTTAAACCTCGAGGTTTAACCTGTTCTTGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001716154.1-448s21c1
Sequence:CCGGCCAACAGCAGGTGCTAGTATACTCGAGTATACTAGCACCTGCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001716154.1-1640s21c1
Sequence:CCGGTATTAGAAGCCGGACCATATACTCGAGTATATGGTCCGGCTTCTAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236690    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001716154.1-3178s21c1
Sequence:CCGGATTGCGTTTGCAGACTAAATTCTCGAGAATTTAGTCTGCAAACGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001716154
VALIDATED
ZSWIM6 MISSION shRNA shRNA Plasmid DNA
zinc finger, SWIM-type containing 6
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000236694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:XM_001716154.1-2466s21c1
Sequence:CCGGTACGACTGGCATGAGCTATACCTCGAGGTATAGCTCATGCCAGTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001716154.1-503s21c1
Sequence:CCGGAGGTTCAAGAACAGGTTAAACCTCGAGGTTTAACCTGTTCTTGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001716154.1-448s21c1
Sequence:CCGGCCAACAGCAGGTGCTAGTATACTCGAGTATACTAGCACCTGCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001716154.1-1640s21c1
Sequence:CCGGTATTAGAAGCCGGACCATATACTCGAGTATATGGTCCGGCTTCTAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236690    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001716154.1-3178s21c1
Sequence:CCGGATTGCGTTTGCAGACTAAATTCTCGAGAATTTAGTCTGCAAACGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001716154
VALIDATED
ZSWIM6 MISSION shRNA Lentiviral Transduction Particles
zinc finger, SWIM-type containing 6
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000236694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:XM_001716154.1-2466s21c1
Sequence:CCGGTACGACTGGCATGAGCTATACCTCGAGGTATAGCTCATGCCAGTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001716154.1-503s21c1
Sequence:CCGGAGGTTCAAGAACAGGTTAAACCTCGAGGTTTAACCTGTTCTTGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001716154.1-448s21c1
Sequence:CCGGCCAACAGCAGGTGCTAGTATACTCGAGTATACTAGCACCTGCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001716154.1-1640s21c1
Sequence:CCGGTATTAGAAGCCGGACCATATACTCGAGTATATGGTCCGGCTTCTAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236690    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001716154.1-3178s21c1
Sequence:CCGGATTGCGTTTGCAGACTAAATTCTCGAGAATTTAGTCTGCAAACGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks