EMAIL THIS PAGE TO A FRIEND

ZSWIM7

zinc finger, SWIM-type containing 7

Synonyms: SWS1
UniProtKB ID: Q19AV6
Gene ID:
Mouse(69747) zinc finger SWIM-type containing 7
Rat(287388) zinc finger, SWIM-type containing 7
naked mole-rat(101708434) zinc finger, SWIM-type containing 7
domestic guinea pig(100721593) zinc finger, SWIM-type containing 7
cow(514094) zinc finger, SWIM-type containing 7
sheep(101118034) zinc finger, SWIM-type containing 7
Zebrafish(325530) zinc finger, SWIM-type containing 7
dog(479517) zinc finger, SWIM-type containing 7
chicken(417596) zinc finger, SWIM-type containing 7
77 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027198 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027198 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027198 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001042697 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001042697 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001042697 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042697 Rosetta Predictions human pricing
NM_001042698 Rosetta Predictions human pricing
XM_213328 Rosetta Predictions rat pricing
XR_009188 Rosetta Predictions rat pricing
XM_001473892 Rosetta Predictions mouse pricing
XM_126343 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042697 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311015 predicted 295
2 SASI_Hs02_00311016 predicted 244
3 SASI_Hs02_00311017 predicted 279
4 SASI_Hs02_00311018 predicted 242
5 SASI_Hs02_00311019 predicted 248
6 SASI_Hs02_00311020 predicted 220
7 SASI_Hs02_00311021 predicted 228
8 SASI_Hs02_00311022 predicted 219
9 SASI_Hs02_00311023 predicted 239
10 SASI_Hs02_00311024 predicted 218
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042698 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311025 predicted 300
2 SASI_Hs02_00311026 predicted 251
3 SASI_Hs02_00311027 predicted 281
4 SASI_Hs02_00311028 predicted 243
5 SASI_Hs02_00311029 predicted 247
6 SASI_Hs02_00311030 predicted 224
7 SASI_Hs02_00311031 predicted 227
8 SASI_Hs02_00311032 predicted 223
9 SASI_Hs02_00311033 predicted 239
10 SASI_Hs02_00311034 predicted 218
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_213328 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00138649 predicted 303
2 SASI_Rn01_00138650 predicted 255
3 SASI_Rn01_00138651 predicted 284
4 SASI_Rn01_00138652 predicted 246
5 SASI_Rn01_00138653 predicted 297
6 SASI_Rn01_00138654 predicted 273
7 SASI_Rn01_00138655 predicted 234
8 SASI_Rn01_00138656 predicted 220
9 SASI_Rn01_00138657 predicted 308
10 SASI_Rn01_00138658 predicted 239
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009188 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00167073 predicted 302
2 SASI_Rn01_00167075 predicted 276
3 SASI_Rn01_00167076 predicted 235
4 SASI_Rn01_00167077 predicted 299
5 SASI_Rn01_00167078 predicted 263
6 SASI_Rn02_00419025 predicted 217
7 SASI_Rn01_00167079 predicted 224
8 SASI_Rn01_00167080 predicted 217
9 SASI_Rn01_00167081 predicted 301
10 SASI_Rn01_00167082 predicted 231
11 SASI_Rn01_00167074 predicted 251
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001473892 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00371476 predicted 303
2 SASI_Mm02_00371477 predicted 267
3 SASI_Mm02_00371478 predicted 273
4 SASI_Mm02_00371479 predicted 321
5 SASI_Mm02_00371480 predicted 298
6 SASI_Mm02_00371481 predicted 202
7 SASI_Mm02_00371482 predicted 329
8 SASI_Mm02_00371483 predicted 297
9 SASI_Mm02_00371484 predicted 269
10 SASI_Mm02_00371485 predicted 334
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_126343 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00220909 predicted 251
2 SASI_Mm01_00220910 predicted 263
3 SASI_Mm01_00220911 predicted 349
4 SASI_Mm01_00220912 predicted 242
5 SASI_Mm01_00220913 predicted 312
6 SASI_Mm01_00220914 predicted 340
7 SASI_Mm01_00220916 predicted 329
8 SASI_Mm02_00424141 predicted 242
9 SASI_Mm02_00424142 predicted 325
10 SASI_Mm02_00424143 predicted 322
11 SASI_Mm01_00220908 predicted 339
12 SASI_Mm01_00220915 predicted 335
13 SASI_Mm01_00220917 predicted 338
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027198
VALIDATED
ZSWIM7 MISSION shRNA Bacterial Glycerol Stock
zinc finger, SWIM-type containing 7
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027198.1-240s21c1
Sequence:CCGGACCCAGTGGAAGGCGTGTTTACTCGAGTAAACACGCCTTCCACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027198.1-372s21c1
Sequence:CCGGTAAGCATCTTCTGGCAATTTACTCGAGTAAATTGCCAGAAGATGCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027198.1-140s21c1
Sequence:CCGGTTCCCGACGAGCTTCTCTTATCTCGAGATAAGAGAAGCTCGTCGGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027198.1-211s21c1
Sequence:CCGGGATCGAGAGTCCGTCACTTTACTCGAGTAAAGTGACGGACTCTCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341709    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027198.1-580s21c1
Sequence:CCGGGACTTGTGACTGTCACTTCACCTCGAGGTGAAGTGACAGTCACAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027198
VALIDATED
ZSWIM7 MISSION shRNA shRNA Plasmid DNA
zinc finger, SWIM-type containing 7
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027198.1-240s21c1
Sequence:CCGGACCCAGTGGAAGGCGTGTTTACTCGAGTAAACACGCCTTCCACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027198.1-372s21c1
Sequence:CCGGTAAGCATCTTCTGGCAATTTACTCGAGTAAATTGCCAGAAGATGCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027198.1-140s21c1
Sequence:CCGGTTCCCGACGAGCTTCTCTTATCTCGAGATAAGAGAAGCTCGTCGGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027198.1-211s21c1
Sequence:CCGGGATCGAGAGTCCGTCACTTTACTCGAGTAAAGTGACGGACTCTCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341709    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027198.1-580s21c1
Sequence:CCGGGACTTGTGACTGTCACTTCACCTCGAGGTGAAGTGACAGTCACAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027198
VALIDATED
ZSWIM7 MISSION shRNA Lentiviral Transduction Particles
zinc finger, SWIM-type containing 7
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027198.1-240s21c1
Sequence:CCGGACCCAGTGGAAGGCGTGTTTACTCGAGTAAACACGCCTTCCACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027198.1-372s21c1
Sequence:CCGGTAAGCATCTTCTGGCAATTTACTCGAGTAAATTGCCAGAAGATGCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027198.1-140s21c1
Sequence:CCGGTTCCCGACGAGCTTCTCTTATCTCGAGATAAGAGAAGCTCGTCGGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027198.1-211s21c1
Sequence:CCGGGATCGAGAGTCCGTCACTTTACTCGAGTAAAGTGACGGACTCTCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341709    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027198.1-580s21c1
Sequence:CCGGGACTTGTGACTGTCACTTCACCTCGAGGTGAAGTGACAGTCACAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001042697
VALIDATED
ZSWIM7 MISSION shRNA Bacterial Glycerol Stock
zinc finger, SWIM-type containing 7
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000255716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001042697.1-423s21c1
Sequence:CCGGGTTTACCTGAGTCAGGTTATGCTCGAGCATAACCTGACTCAGGTAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255715    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042697.1-1566s21c1
Sequence:CCGGTAGATGACAGAAGGAGTATTACTCGAGTAATACTCCTTCTGTCATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001042697.1-300s21c1
Sequence:CCGGGTCCTTGGAAGTTCCAGTAAACTCGAGTTTACTGGAACTTCCAAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001042697.1-475s21c1
Sequence:CCGGAGCAGTTGACTGACATATTATCTCGAGATAATATGTCAGTCAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001042697.1-248s21c1
Sequence:CCGGTCGACAGTCCATCACCTTAATCTCGAGATTAAGGTGATGGACTGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001042697
VALIDATED
ZSWIM7 MISSION shRNA shRNA Plasmid DNA
zinc finger, SWIM-type containing 7
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000255716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001042697.1-423s21c1
Sequence:CCGGGTTTACCTGAGTCAGGTTATGCTCGAGCATAACCTGACTCAGGTAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255715    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042697.1-1566s21c1
Sequence:CCGGTAGATGACAGAAGGAGTATTACTCGAGTAATACTCCTTCTGTCATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001042697.1-300s21c1
Sequence:CCGGGTCCTTGGAAGTTCCAGTAAACTCGAGTTTACTGGAACTTCCAAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001042697.1-475s21c1
Sequence:CCGGAGCAGTTGACTGACATATTATCTCGAGATAATATGTCAGTCAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001042697.1-248s21c1
Sequence:CCGGTCGACAGTCCATCACCTTAATCTCGAGATTAAGGTGATGGACTGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001042697
VALIDATED
ZSWIM7 MISSION shRNA Lentiviral Transduction Particles
zinc finger, SWIM-type containing 7
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000255716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001042697.1-423s21c1
Sequence:CCGGGTTTACCTGAGTCAGGTTATGCTCGAGCATAACCTGACTCAGGTAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255715    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042697.1-1566s21c1
Sequence:CCGGTAGATGACAGAAGGAGTATTACTCGAGTAATACTCCTTCTGTCATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001042697.1-300s21c1
Sequence:CCGGGTCCTTGGAAGTTCCAGTAAACTCGAGTTTACTGGAACTTCCAAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001042697.1-475s21c1
Sequence:CCGGAGCAGTTGACTGACATATTATCTCGAGATAATATGTCAGTCAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001042697.1-248s21c1
Sequence:CCGGTCGACAGTCCATCACCTTAATCTCGAGATTAAGGTGATGGACTGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks