EMAIL THIS PAGE TO A FRIEND

ZSWIM8

zinc finger, SWIM-type containing 8

Synonyms: KIAA0913
Gene ID:
Mouse(268721) zinc finger SWIM-type containing 8
Rat(361004) zinc finger, SWIM-type containing 8
Zebrafish(100148379) zinc finger, SWIM-type containing 8
domestic cat(101097843) zinc finger, SWIM-type containing 8
cow(533041) KIAA0913 ortholog
sheep(101120297) zinc finger, SWIM-type containing 8
domestic guinea pig(100721542) zinc finger, SWIM-type containing 8
naked mole-rat(101712138) zinc finger, SWIM-type containing 8
205 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA041244 Anti-ZSWIM8 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027996 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027996 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027996 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015037 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015037 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015037 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU160071 MISSION® esiRNA esiRNA targeting mouse 2310021P13Rik mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015037 Rosetta Predictions human pricing
XM_001057186 Rosetta Predictions rat pricing
XM_341279 Rosetta Predictions rat pricing
NM_027996 Rosetta Predictions mouse pricing
XM_975136 Rosetta Predictions mouse pricing
XM_975587 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015037 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00346855 predicted 4741
2 SASI_Hs01_00102612 predicted 4350
3 SASI_Hs02_00346856 predicted 891
4 SASI_Hs02_00346857 predicted 1881
5 SASI_Hs01_00102614 predicted 4151
6 SASI_Hs02_00346858 predicted 2803
7 SASI_Hs01_00102615 predicted 3049
8 SASI_Hs02_00346859 predicted 1080
9 SASI_Hs01_00102616 predicted 4009
10 SASI_Hs01_00102618 predicted 2602
11 SASI_Hs01_00102610 predicted 569
12 SASI_Hs01_00102611 predicted 584
13 SASI_Hs01_00102613 predicted 1455
14 SASI_Hs01_00102617 predicted 796
15 SASI_Hs01_00102619 predicted 3236
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057186 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00285697 predicted 1657
2 SASI_Rn02_00285698 predicted 2600
3 SASI_Rn02_00285699 predicted 3330
4 SASI_Rn02_00285700 predicted 3937
5 SASI_Rn02_00285701 predicted 751
6 SASI_Rn02_00285702 predicted 3283
7 SASI_Rn02_00285703 predicted 5363
8 SASI_Rn02_00285704 predicted 1559
9 SASI_Rn02_00285705 predicted 3718
10 SASI_Rn02_00285706 predicted 4157
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341279 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392668 predicted 1651
2 SASI_Rn02_00392669 predicted 2605
3 SASI_Rn02_00392670 predicted 3331
4 SASI_Rn02_00392671 predicted 3934
5 SASI_Rn02_00392672 predicted 753
6 SASI_Rn02_00392673 predicted 3278
7 SASI_Rn02_00392674 predicted 5369
8 SASI_Rn02_00392675 predicted 1563
9 SASI_Rn02_00392676 predicted 3719
10 SASI_Rn02_00392677 predicted 4162
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027996 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00333075 predicted 745
2 SASI_Mm02_00333076 predicted 5233
3 SASI_Mm02_00333077 predicted 4610
4 SASI_Mm02_00333078 predicted 5688
5 SASI_Mm02_00333079 predicted 1155
6 SASI_Mm02_00333080 predicted 4772
7 SASI_Mm02_00333081 predicted 5587
8 SASI_Mm02_00333082 predicted 1251
9 SASI_Mm02_00333083 predicted 3540
10 SASI_Mm02_00333084 predicted 501
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_975136 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00261837 predicted 544
2 SASI_Mm01_00261838 predicted 853
3 SASI_Mm01_00261839 predicted 1657
4 SASI_Mm01_00261840 predicted 759
5 SASI_Mm01_00261841 predicted 1166
6 SASI_Mm01_00261842 predicted 2014
7 SASI_Mm01_00261843 predicted 1520
8 SASI_Mm01_00261844 predicted 570
9 SASI_Mm01_00261845 predicted 2705
10 SASI_Mm01_00261846 predicted 1269
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_975587 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00211687 predicted 4623
2 SASI_Mm01_00211688 predicted 5700
3 SASI_Mm01_00211689 predicted 3343
4 SASI_Mm01_00211690 predicted 4781
5 SASI_Mm01_00211691 predicted 3292
6 SASI_Mm01_00211692 predicted 4175
7 SASI_Mm01_00211693 predicted 3550
8 SASI_Mm01_00211694 predicted 3593
9 SASI_Mm01_00211695 predicted 4532
10 SASI_Mm01_00211696 predicted 4991
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027996
VALIDATED
ZSWIM8 MISSION shRNA Bacterial Glycerol Stock
zinc finger, SWIM-type containing 8
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027996.2-3655s21c1
Sequence:CCGGGGCAGTCGTGGAGGTTATAATCTCGAGATTATAACCTCCACGACTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027996.2-2466s21c1
Sequence:CCGGTGACGACTACCAAGCATATTACTCGAGTAATATGCTTGGTAGTCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027996.2-4018s21c1
Sequence:CCGGGCACACTTCTACTTCGAATTGCTCGAGCAATTCGAAGTAGAAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267930    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027996.2-5873s21c1
Sequence:CCGGCTCTTGGCTGGACAGATCATCCTCGAGGATGATCTGTCCAGCCAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027996.2-5593s21c1
Sequence:CCGGTACATCCATCACCGCTTAATTCTCGAGAATTAAGCGGTGATGGATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027996
VALIDATED
ZSWIM8 MISSION shRNA shRNA Plasmid DNA
zinc finger, SWIM-type containing 8
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027996.2-3655s21c1
Sequence:CCGGGGCAGTCGTGGAGGTTATAATCTCGAGATTATAACCTCCACGACTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027996.2-2466s21c1
Sequence:CCGGTGACGACTACCAAGCATATTACTCGAGTAATATGCTTGGTAGTCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027996.2-4018s21c1
Sequence:CCGGGCACACTTCTACTTCGAATTGCTCGAGCAATTCGAAGTAGAAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267930    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027996.2-5873s21c1
Sequence:CCGGCTCTTGGCTGGACAGATCATCCTCGAGGATGATCTGTCCAGCCAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027996.2-5593s21c1
Sequence:CCGGTACATCCATCACCGCTTAATTCTCGAGAATTAAGCGGTGATGGATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027996
VALIDATED
ZSWIM8 MISSION shRNA Lentiviral Transduction Particles
zinc finger, SWIM-type containing 8
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027996.2-3655s21c1
Sequence:CCGGGGCAGTCGTGGAGGTTATAATCTCGAGATTATAACCTCCACGACTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027996.2-2466s21c1
Sequence:CCGGTGACGACTACCAAGCATATTACTCGAGTAATATGCTTGGTAGTCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027996.2-4018s21c1
Sequence:CCGGGCACACTTCTACTTCGAATTGCTCGAGCAATTCGAAGTAGAAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267930    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027996.2-5873s21c1
Sequence:CCGGCTCTTGGCTGGACAGATCATCCTCGAGGATGATCTGTCCAGCCAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027996.2-5593s21c1
Sequence:CCGGTACATCCATCACCGCTTAATTCTCGAGAATTAAGCGGTGATGGATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015037
ZSWIM8 MISSION shRNA Bacterial Glycerol Stock
zinc finger, SWIM-type containing 8
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015037.1-1715s1c1
Sequence:CCGGCAACTGGCTCTCACGTACTTACTCGAGTAAGTACGTGAGAGCCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163100    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015037.1-3408s1c1
Sequence:CCGGGTGAAACTTGGCTGGACAGATCTCGAGATCTGTCCAGCCAAGTTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015037.1-2052s1c1
Sequence:CCGGCCTGAAGTGTTGTTTGAGGTTCTCGAGAACCTCAAACAACACTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015037.1-833s1c1
Sequence:CCGGGCTTAAGAAGATCTTAGACAACTCGAGTTGTCTAAGATCTTCTTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161500    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015037.1-3245s1c1
Sequence:CCGGGTTCAACGACATCCTACAGAACTCGAGTTCTGTAGGATGTCGTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015037.1-1665s1c1
Sequence:CCGGGCCTTCGAGATTGGGCTTTATCTCGAGATAAAGCCCAATCTCGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135410    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015037.1-256s1c1
Sequence:CCGGGCAAGAAGAACAAGGTATCCACTCGAGTGGATACCTTGTTCTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015037
ZSWIM8 MISSION shRNA shRNA Plasmid DNA
zinc finger, SWIM-type containing 8
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015037.1-1715s1c1
Sequence:CCGGCAACTGGCTCTCACGTACTTACTCGAGTAAGTACGTGAGAGCCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163100    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015037.1-3408s1c1
Sequence:CCGGGTGAAACTTGGCTGGACAGATCTCGAGATCTGTCCAGCCAAGTTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015037.1-2052s1c1
Sequence:CCGGCCTGAAGTGTTGTTTGAGGTTCTCGAGAACCTCAAACAACACTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015037.1-833s1c1
Sequence:CCGGGCTTAAGAAGATCTTAGACAACTCGAGTTGTCTAAGATCTTCTTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161500    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015037.1-3245s1c1
Sequence:CCGGGTTCAACGACATCCTACAGAACTCGAGTTCTGTAGGATGTCGTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015037.1-1665s1c1
Sequence:CCGGGCCTTCGAGATTGGGCTTTATCTCGAGATAAAGCCCAATCTCGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135410    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015037.1-256s1c1
Sequence:CCGGGCAAGAAGAACAAGGTATCCACTCGAGTGGATACCTTGTTCTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015037
ZSWIM8 MISSION shRNA Lentiviral Transduction Particles
zinc finger, SWIM-type containing 8
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015037.1-1715s1c1
Sequence:CCGGCAACTGGCTCTCACGTACTTACTCGAGTAAGTACGTGAGAGCCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163100    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015037.1-3408s1c1
Sequence:CCGGGTGAAACTTGGCTGGACAGATCTCGAGATCTGTCCAGCCAAGTTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015037.1-2052s1c1
Sequence:CCGGCCTGAAGTGTTGTTTGAGGTTCTCGAGAACCTCAAACAACACTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015037.1-833s1c1
Sequence:CCGGGCTTAAGAAGATCTTAGACAACTCGAGTTGTCTAAGATCTTCTTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161500    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015037.1-3245s1c1
Sequence:CCGGGTTCAACGACATCCTACAGAACTCGAGTTCTGTAGGATGTCGTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015037.1-1665s1c1
Sequence:CCGGGCCTTCGAGATTGGGCTTTATCTCGAGATAAAGCCCAATCTCGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135410    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015037.1-256s1c1
Sequence:CCGGGCAAGAAGAACAAGGTATCCACTCGAGTGGATACCTTGTTCTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks