EMAIL THIS PAGE TO A FRIEND

ZUFSP

zinc finger with UFM1-specific peptidase domain

Synonyms: C6orf113 dJ412I7.3
UniProtKB ID: Q96AP4, Q5TD92, Q6PJH7, Q96NV6
Gene ID:
Mouse(72580) zinc finger with UFM1-specific peptidase domain
Rat(294390) zinc finger with UFM1-specific peptidase domain
Zebrafish(562478) zinc finger with UFM1-specific peptidase domain
chicken(421739) zinc finger with UFM1-specific peptidase domain
dog(476272) zinc finger with UFM1-specific peptidase domain
Horse(100067070) zinc finger with UFM1-specific peptidase domain
domestic cat(101092115) zinc finger with UFM1-specific peptidase domain
naked mole-rat(101703433) zinc finger with UFM1-specific peptidase domain
Domestic Rabbit(100342806) zinc finger with UFM1-specific peptidase domain
domestic guinea pig(100717992) zinc finger with UFM1-specific peptidase domain
cow(533724) zinc finger with UFM1-specific peptidase domain
sheep(101104755) zinc finger with UFM1-specific peptidase domain
62 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145062 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145062 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145062 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028287 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028287 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028287 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145062 Rosetta Predictions human pricing
NM_001008308 Rosetta Predictions rat pricing
NM_028287 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145062 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00364963 predicted 702
2 SASI_Hs01_00191576 predicted 420
3 SASI_Hs01_00191577 predicted 1950
4 SASI_Hs01_00191578 predicted 499
5 SASI_Hs01_00191579 predicted 357
6 SASI_Hs01_00191580 predicted 742
7 SASI_Hs01_00191581 predicted 1510
8 SASI_Hs01_00191582 predicted 244
9 SASI_Hs01_00191583 predicted 1975
10 SASI_Hs02_00364964 predicted 424
11 SASI_Hs01_00191584 predicted 599
12 SASI_Hs01_00191585 predicted 301
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008308 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00092198 predicted 513
2 SASI_Rn01_00092199 predicted 1712
3 SASI_Rn02_00199028 predicted 502
4 SASI_Rn01_00092200 predicted 402
5 SASI_Rn01_00092202 predicted 579
6 SASI_Rn01_00092203 predicted 1234
7 SASI_Rn01_00092204 predicted 327
8 SASI_Rn01_00092205 predicted 1209
9 SASI_Rn01_00092206 predicted 1269
10 SASI_Rn02_00199029 predicted 395
11 SASI_Rn01_00092197 predicted 1065
12 SASI_Rn01_00092201 predicted 1699
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028287 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054371 predicted 328
2 SASI_Mm01_00054372 predicted 419
3 SASI_Mm01_00054374 predicted 707
4 SASI_Mm01_00054375 predicted 1399
5 SASI_Mm02_00333638 predicted 1472
6 SASI_Mm02_00333639 predicted 1966
7 SASI_Mm02_00333640 predicted 698
8 SASI_Mm02_00333641 predicted 424
9 SASI_Mm02_00333642 predicted 1981
10 SASI_Mm01_00054377 predicted 316
11 SASI_Mm01_00054370 predicted 531
12 SASI_Mm01_00054373 predicted 2011
13 SASI_Mm01_00054376 predicted 581
14 SASI_Mm01_00054378 predicted 467
15 SASI_Mm01_00054379 predicted 232
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145062
VALIDATED
ZUFSP MISSION shRNA Bacterial Glycerol Stock
zinc finger with UFM1-specific peptidase domain
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_145062.1-905s1c1
Sequence:CCGGGCTTTCAGCAAGGCATGGATACTCGAGTATCCATGCCTTGCTGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_145062.1-1551s1c1
Sequence:CCGGCCTAAGGGTAAAGTGTCATATCTCGAGATATGACACTTTACCCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_145062.1-490s1c1
Sequence:CCGGCAGTGTGGAATGGAAGTTAATCTCGAGATTAACTTCCATTCCACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_145062.1-1611s1c1
Sequence:CCGGCCCTCGCTTATTTGAATGGATCTCGAGATCCATTCAAATAAGCGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150071    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145062.1-877s1c1
Sequence:CCGGCATGTTGACTTGCATTTGGAACTCGAGTTCCAAATGCAAGTCAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_145062.1-1943s1c1
Sequence:CCGGGACAAGCTTCTCAAGTCTTTACTCGAGTAAAGACTTGAGAAGCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_145062.1-290s1c1
Sequence:CCGGCAGACATGAAAGCTCACCTAACTCGAGTTAGGTGAGCTTTCATGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_145062.1-348s1c1
Sequence:CCGGCAAGTTGTCAGGTGTGAATTACTCGAGTAATTCACACCTGACAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145062.1-1216s21c1
Sequence:CCGGGAAGCACTTCATAGGTATTATCTCGAGATAATACCTATGAAGTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_145062.1-653s21c1
Sequence:CCGGAGTCCAGCCTGACCGAAATAACTCGAGTTATTTCGGTCAGGCTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145062.1-1603s21c1
Sequence:CCGGGGTACACACCCTCGCTTATTTCTCGAGAAATAAGCGAGGGTGTGTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_145062.1-1075s21c1
Sequence:GTACCGGCAACAACAACTACGAAATATGCTCGAGCATATTTCGTAGTTGTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219807    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_145062.1-2008s1c1
Sequence:CCGGGTGATTGAGAACAATACTTTGCTCGAGCAAAGTATTGTTCTCAATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219806    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145062.1-1994s1c1
Sequence:CCGGATTTAAGCATTTCAGTGATTGCTCGAGCAATCACTGAAATGCTTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229399    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145062.1-2008s21c1
Sequence:CCGGGTGATTGAGAACAATACTTTGCTCGAGCAAAGTATTGTTCTCAATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145062
VALIDATED
ZUFSP MISSION shRNA shRNA Plasmid DNA
zinc finger with UFM1-specific peptidase domain
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_145062.1-905s1c1
Sequence:CCGGGCTTTCAGCAAGGCATGGATACTCGAGTATCCATGCCTTGCTGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_145062.1-1551s1c1
Sequence:CCGGCCTAAGGGTAAAGTGTCATATCTCGAGATATGACACTTTACCCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_145062.1-490s1c1
Sequence:CCGGCAGTGTGGAATGGAAGTTAATCTCGAGATTAACTTCCATTCCACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_145062.1-1611s1c1
Sequence:CCGGCCCTCGCTTATTTGAATGGATCTCGAGATCCATTCAAATAAGCGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150071    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145062.1-877s1c1
Sequence:CCGGCATGTTGACTTGCATTTGGAACTCGAGTTCCAAATGCAAGTCAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_145062.1-1943s1c1
Sequence:CCGGGACAAGCTTCTCAAGTCTTTACTCGAGTAAAGACTTGAGAAGCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_145062.1-290s1c1
Sequence:CCGGCAGACATGAAAGCTCACCTAACTCGAGTTAGGTGAGCTTTCATGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_145062.1-348s1c1
Sequence:CCGGCAAGTTGTCAGGTGTGAATTACTCGAGTAATTCACACCTGACAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145062.1-1216s21c1
Sequence:CCGGGAAGCACTTCATAGGTATTATCTCGAGATAATACCTATGAAGTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_145062.1-653s21c1
Sequence:CCGGAGTCCAGCCTGACCGAAATAACTCGAGTTATTTCGGTCAGGCTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145062.1-1603s21c1
Sequence:CCGGGGTACACACCCTCGCTTATTTCTCGAGAAATAAGCGAGGGTGTGTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_145062.1-1075s21c1
Sequence:GTACCGGCAACAACAACTACGAAATATGCTCGAGCATATTTCGTAGTTGTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219807    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_145062.1-2008s1c1
Sequence:CCGGGTGATTGAGAACAATACTTTGCTCGAGCAAAGTATTGTTCTCAATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219806    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145062.1-1994s1c1
Sequence:CCGGATTTAAGCATTTCAGTGATTGCTCGAGCAATCACTGAAATGCTTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229399    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145062.1-2008s21c1
Sequence:CCGGGTGATTGAGAACAATACTTTGCTCGAGCAAAGTATTGTTCTCAATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145062
VALIDATED
ZUFSP MISSION shRNA Lentiviral Transduction Particles
zinc finger with UFM1-specific peptidase domain
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_145062.1-905s1c1
Sequence:CCGGGCTTTCAGCAAGGCATGGATACTCGAGTATCCATGCCTTGCTGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_145062.1-1551s1c1
Sequence:CCGGCCTAAGGGTAAAGTGTCATATCTCGAGATATGACACTTTACCCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_145062.1-490s1c1
Sequence:CCGGCAGTGTGGAATGGAAGTTAATCTCGAGATTAACTTCCATTCCACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_145062.1-1611s1c1
Sequence:CCGGCCCTCGCTTATTTGAATGGATCTCGAGATCCATTCAAATAAGCGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150071    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145062.1-877s1c1
Sequence:CCGGCATGTTGACTTGCATTTGGAACTCGAGTTCCAAATGCAAGTCAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_145062.1-1943s1c1
Sequence:CCGGGACAAGCTTCTCAAGTCTTTACTCGAGTAAAGACTTGAGAAGCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_145062.1-290s1c1
Sequence:CCGGCAGACATGAAAGCTCACCTAACTCGAGTTAGGTGAGCTTTCATGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_145062.1-348s1c1
Sequence:CCGGCAAGTTGTCAGGTGTGAATTACTCGAGTAATTCACACCTGACAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145062.1-1216s21c1
Sequence:CCGGGAAGCACTTCATAGGTATTATCTCGAGATAATACCTATGAAGTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_145062.1-653s21c1
Sequence:CCGGAGTCCAGCCTGACCGAAATAACTCGAGTTATTTCGGTCAGGCTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145062.1-1603s21c1
Sequence:CCGGGGTACACACCCTCGCTTATTTCTCGAGAAATAAGCGAGGGTGTGTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_145062.1-1075s21c1
Sequence:GTACCGGCAACAACAACTACGAAATATGCTCGAGCATATTTCGTAGTTGTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219807    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_145062.1-2008s1c1
Sequence:CCGGGTGATTGAGAACAATACTTTGCTCGAGCAAAGTATTGTTCTCAATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219806    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145062.1-1994s1c1
Sequence:CCGGATTTAAGCATTTCAGTGATTGCTCGAGCAATCACTGAAATGCTTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229399    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145062.1-2008s21c1
Sequence:CCGGGTGATTGAGAACAATACTTTGCTCGAGCAAAGTATTGTTCTCAATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028287
VALIDATED
ZUFSP MISSION shRNA Bacterial Glycerol Stock
zinc finger with UFM1-specific peptidase domain
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000173782    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028287.1-994s1c1
Sequence:CCGGCAGAAGTTGCAGCGGCAATATCTCGAGATATTGCCGCTGCAACTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194226    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028287.1-637s1c1
Sequence:CCGGGCCCAAGGATCAATTTATGAACTCGAGTTCATAAATTGATCCTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241317    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028287.1-1955s21c1
Sequence:CCGGTTATCTCCTCATAACTCATTCCTCGAGGAATGAGTTATGAGGAGATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028287.1-1570s21c1
Sequence:CCGGGGTACACACCCTCGCTTATTTCTCGAGAAATAAGCGAGGGTGTGTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028287.1-315s21c1
Sequence:CCGGTTGCAAGTTGTCAGGTATAAACTCGAGTTTATACCTGACAACTTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028287.1-1727s21c1
Sequence:CCGGCATTATGCTTGCTAGTATTTGCTCGAGCAAATACTAGCAAGCATAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028287.1-1522s21c1
Sequence:CCGGAGAGTAAAGTGCCGCATTATTCTCGAGAATAATGCGGCACTTTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216273    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028287.1-1961s1c1
Sequence:CCGGCCTCATAACTCATTCTATTTCCTCGAGGAAATAGAATGAGTTATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028287
VALIDATED
ZUFSP MISSION shRNA shRNA Plasmid DNA
zinc finger with UFM1-specific peptidase domain
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000173782    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028287.1-994s1c1
Sequence:CCGGCAGAAGTTGCAGCGGCAATATCTCGAGATATTGCCGCTGCAACTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194226    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028287.1-637s1c1
Sequence:CCGGGCCCAAGGATCAATTTATGAACTCGAGTTCATAAATTGATCCTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241317    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028287.1-1955s21c1
Sequence:CCGGTTATCTCCTCATAACTCATTCCTCGAGGAATGAGTTATGAGGAGATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028287.1-1570s21c1
Sequence:CCGGGGTACACACCCTCGCTTATTTCTCGAGAAATAAGCGAGGGTGTGTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028287.1-315s21c1
Sequence:CCGGTTGCAAGTTGTCAGGTATAAACTCGAGTTTATACCTGACAACTTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028287.1-1727s21c1
Sequence:CCGGCATTATGCTTGCTAGTATTTGCTCGAGCAAATACTAGCAAGCATAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028287.1-1522s21c1
Sequence:CCGGAGAGTAAAGTGCCGCATTATTCTCGAGAATAATGCGGCACTTTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216273    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028287.1-1961s1c1
Sequence:CCGGCCTCATAACTCATTCTATTTCCTCGAGGAAATAGAATGAGTTATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028287
VALIDATED
ZUFSP MISSION shRNA Lentiviral Transduction Particles
zinc finger with UFM1-specific peptidase domain
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000173782    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028287.1-994s1c1
Sequence:CCGGCAGAAGTTGCAGCGGCAATATCTCGAGATATTGCCGCTGCAACTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194226    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028287.1-637s1c1
Sequence:CCGGGCCCAAGGATCAATTTATGAACTCGAGTTCATAAATTGATCCTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241317    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028287.1-1955s21c1
Sequence:CCGGTTATCTCCTCATAACTCATTCCTCGAGGAATGAGTTATGAGGAGATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028287.1-1570s21c1
Sequence:CCGGGGTACACACCCTCGCTTATTTCTCGAGAAATAAGCGAGGGTGTGTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028287.1-315s21c1
Sequence:CCGGTTGCAAGTTGTCAGGTATAAACTCGAGTTTATACCTGACAACTTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028287.1-1727s21c1
Sequence:CCGGCATTATGCTTGCTAGTATTTGCTCGAGCAAATACTAGCAAGCATAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028287.1-1522s21c1
Sequence:CCGGAGAGTAAAGTGCCGCATTATTCTCGAGAATAATGCGGCACTTTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216273    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028287.1-1961s1c1
Sequence:CCGGCCTCATAACTCATTCTATTTCCTCGAGGAAATAGAATGAGTTATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks