EMAIL THIS PAGE TO A FRIEND

ZW10

zw10 kinetochore protein

Synonyms: HZW10 KNTC1AP
UniProtKB ID: O43264
Gene ID:
Human(9183) Summary: This gene encodes a protein that is one of many involved in mechanisms to ensure proper chromosome segregation during cell division. This protein is an essential component of the mitotic checkpoint, which prevents cells from prematurely exiting mitosis. [provided by RefSeq, Aug 2011]
Mouse(26951) zw10 kinetochore protein
Rat(363059) zw10 kinetochore protein
Zebrafish(393110) ZW10 homolog, centromere/kinetochore protein (Drosophila)
chicken(395275) ZW10, kinetochore associated, homolog (Drosophila)
dog(479433) ZW10, kinetochore associated, homolog (Drosophila)
Horse(100062230) ZW10, kinetochore associated, homolog (Drosophila)
domestic cat(101097271) ZW10, kinetochore associated, homolog (Drosophila)
cow(511084) ZW10, kinetochore associated, homolog (Drosophila)
sheep(101113954) ZW10, kinetochore associated, homolog (Drosophila)
domestic guinea pig(100732304) zw10 kinetochore protein
naked mole-rat(101713165) zw10 kinetochore protein
73 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004724 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004724 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004724 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_012039 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_012039 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_012039 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU050301 MISSION® esiRNA esiRNA human ZW10 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004724 Rosetta Predictions human pricing
NM_001024801 Rosetta Predictions rat pricing
NM_012039 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004724 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242458 predicted 2214
2 SASI_Hs01_00242459 predicted 1657
3 SASI_Hs01_00242460 predicted 1501
4 SASI_Hs01_00242462 predicted 1152
5 SASI_Hs01_00242463 predicted 1302
6 SASI_Hs01_00242464 predicted 1594
7 SASI_Hs02_00338199 predicted 2419
8 SASI_Hs01_00242465 predicted 1967
9 SASI_Hs01_00242466 predicted 1523
10 SASI_Hs01_00242467 predicted 2199
11 SASI_Hs01_00242461 predicted 1339
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024801 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00094260 predicted 1292
2 SASI_Rn01_00094261 predicted 337
3 SASI_Rn01_00094262 predicted 1697
4 SASI_Rn01_00094263 predicted 1346
5 SASI_Rn01_00094264 predicted 1574
6 SASI_Rn01_00094265 predicted 656
7 SASI_Rn01_00094266 predicted 1329
8 SASI_Rn01_00094267 predicted 1226
9 SASI_Rn02_00202726 predicted 440
10 SASI_Rn01_00094269 predicted 1918
11 SASI_Rn01_00094268 predicted 1620
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012039 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00137014 predicted 863
2 SASI_Mm01_00137015 predicted 1218
3 SASI_Mm01_00137016 predicted 2188
4 SASI_Mm01_00137017 predicted 1260
5 SASI_Mm01_00137018 predicted 792
6 SASI_Mm01_00137019 predicted 408
7 SASI_Mm02_00322005 predicted 1892
8 SASI_Mm01_00137023 predicted 1195
9 SASI_Mm02_00322006 predicted 2116
10 SASI_Mm02_00322007 predicted 303
11 SASI_Mm01_00137020 predicted 1588
12 SASI_Mm01_00137021 predicted 2202
13 SASI_Mm01_00137022 predicted 1349
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004724
VALIDATED
ZW10 MISSION shRNA Bacterial Glycerol Stock
zw10 kinetochore protein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004724.2-815s21c1
Sequence:CCGGCCATCCCTTCATGCTGTGATACTCGAGTATCACAGCATGAAGGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004724.2-293s21c1
Sequence:CCGGCACGTATCAACCGGTGAATTTCTCGAGAAATTCACCGGTTGATACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004724.2-2200s21c1
Sequence:CCGGGCCATTCAAGGAATTGATGATCTCGAGATCATCAATTCCTTGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004724.2-1124s21c1
Sequence:CCGGGAGATCATACAGTCCACTGAACTCGAGTTCAGTGGACTGTATGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004724.2-815s1c1
Sequence:CCGGCCATCCCTTCATGCTGTGATACTCGAGTATCACAGCATGAAGGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004724.2-1124s1c1
Sequence:CCGGGAGATCATACAGTCCACTGAACTCGAGTTCAGTGGACTGTATGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004724.2-239s1c1
Sequence:CCGGGAAGACATTGACCTGCTGAAACTCGAGTTTCAGCAGGTCAATGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004724.2-2200s1c1
Sequence:CCGGGCCATTCAAGGAATTGATGATCTCGAGATCATCAATTCCTTGAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004724.2-1594s1c1
Sequence:CCGGCCATGATGTTGTACCAACATACTCGAGTATGTTGGTACAACATCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004724
VALIDATED
ZW10 MISSION shRNA shRNA Plasmid DNA
zw10 kinetochore protein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004724.2-815s21c1
Sequence:CCGGCCATCCCTTCATGCTGTGATACTCGAGTATCACAGCATGAAGGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004724.2-293s21c1
Sequence:CCGGCACGTATCAACCGGTGAATTTCTCGAGAAATTCACCGGTTGATACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004724.2-2200s21c1
Sequence:CCGGGCCATTCAAGGAATTGATGATCTCGAGATCATCAATTCCTTGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004724.2-1124s21c1
Sequence:CCGGGAGATCATACAGTCCACTGAACTCGAGTTCAGTGGACTGTATGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004724.2-815s1c1
Sequence:CCGGCCATCCCTTCATGCTGTGATACTCGAGTATCACAGCATGAAGGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004724.2-1124s1c1
Sequence:CCGGGAGATCATACAGTCCACTGAACTCGAGTTCAGTGGACTGTATGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004724.2-239s1c1
Sequence:CCGGGAAGACATTGACCTGCTGAAACTCGAGTTTCAGCAGGTCAATGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004724.2-2200s1c1
Sequence:CCGGGCCATTCAAGGAATTGATGATCTCGAGATCATCAATTCCTTGAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004724.2-1594s1c1
Sequence:CCGGCCATGATGTTGTACCAACATACTCGAGTATGTTGGTACAACATCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004724
VALIDATED
ZW10 MISSION shRNA Lentiviral Transduction Particles
zw10 kinetochore protein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004724.2-815s21c1
Sequence:CCGGCCATCCCTTCATGCTGTGATACTCGAGTATCACAGCATGAAGGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004724.2-293s21c1
Sequence:CCGGCACGTATCAACCGGTGAATTTCTCGAGAAATTCACCGGTTGATACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004724.2-2200s21c1
Sequence:CCGGGCCATTCAAGGAATTGATGATCTCGAGATCATCAATTCCTTGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004724.2-1124s21c1
Sequence:CCGGGAGATCATACAGTCCACTGAACTCGAGTTCAGTGGACTGTATGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004724.2-815s1c1
Sequence:CCGGCCATCCCTTCATGCTGTGATACTCGAGTATCACAGCATGAAGGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004724.2-1124s1c1
Sequence:CCGGGAGATCATACAGTCCACTGAACTCGAGTTCAGTGGACTGTATGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004724.2-239s1c1
Sequence:CCGGGAAGACATTGACCTGCTGAAACTCGAGTTTCAGCAGGTCAATGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004724.2-2200s1c1
Sequence:CCGGGCCATTCAAGGAATTGATGATCTCGAGATCATCAATTCCTTGAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004724.2-1594s1c1
Sequence:CCGGCCATGATGTTGTACCAACATACTCGAGTATGTTGGTACAACATCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012039
VALIDATED
ZW10 MISSION shRNA Bacterial Glycerol Stock
zw10 kinetochore protein
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000316447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012039.1-1225s21c1
Sequence:CCGGGCTCGCAATATCAATTCTCATCTCGAGATGAGAATTGATATTGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012039.1-2075s21c1
Sequence:CCGGCGACTGAAGATGGTGATAGATCTCGAGATCTATCACCATCTTCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012039.1-1330s21c1
Sequence:CCGGCCCGATTGTAAGGAAGCCTTACTCGAGTAAGGCTTCCTTACAATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012039.1-771s21c1
Sequence:CCGGGCTGAAGTCATTTGGTCAGATCTCGAGATCTGACCAAATGACTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012039.1-771s1c1
Sequence:CCGGGCTGAAGTCATTTGGTCAGATCTCGAGATCTGACCAAATGACTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098185    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012039.1-2489s1c1
Sequence:CCGGCCAGTATATCATGGAAGCGTACTCGAGTACGCTTCCATGATATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012039.1-1330s1c1
Sequence:CCGGCCCGATTGTAAGGAAGCCTTACTCGAGTAAGGCTTCCTTACAATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012039.1-1225s1c1
Sequence:CCGGGCTCGCAATATCAATTCTCATCTCGAGATGAGAATTGATATTGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012039.1-2075s1c1
Sequence:CCGGCGACTGAAGATGGTGATAGATCTCGAGATCTATCACCATCTTCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012039
VALIDATED
ZW10 MISSION shRNA shRNA Plasmid DNA
zw10 kinetochore protein
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000316447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012039.1-1225s21c1
Sequence:CCGGGCTCGCAATATCAATTCTCATCTCGAGATGAGAATTGATATTGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012039.1-2075s21c1
Sequence:CCGGCGACTGAAGATGGTGATAGATCTCGAGATCTATCACCATCTTCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012039.1-1330s21c1
Sequence:CCGGCCCGATTGTAAGGAAGCCTTACTCGAGTAAGGCTTCCTTACAATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012039.1-771s21c1
Sequence:CCGGGCTGAAGTCATTTGGTCAGATCTCGAGATCTGACCAAATGACTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012039.1-771s1c1
Sequence:CCGGGCTGAAGTCATTTGGTCAGATCTCGAGATCTGACCAAATGACTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098185    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012039.1-2489s1c1
Sequence:CCGGCCAGTATATCATGGAAGCGTACTCGAGTACGCTTCCATGATATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012039.1-1330s1c1
Sequence:CCGGCCCGATTGTAAGGAAGCCTTACTCGAGTAAGGCTTCCTTACAATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012039.1-1225s1c1
Sequence:CCGGGCTCGCAATATCAATTCTCATCTCGAGATGAGAATTGATATTGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012039.1-2075s1c1
Sequence:CCGGCGACTGAAGATGGTGATAGATCTCGAGATCTATCACCATCTTCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012039
VALIDATED
ZW10 MISSION shRNA Lentiviral Transduction Particles
zw10 kinetochore protein
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000316447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012039.1-1225s21c1
Sequence:CCGGGCTCGCAATATCAATTCTCATCTCGAGATGAGAATTGATATTGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012039.1-2075s21c1
Sequence:CCGGCGACTGAAGATGGTGATAGATCTCGAGATCTATCACCATCTTCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012039.1-1330s21c1
Sequence:CCGGCCCGATTGTAAGGAAGCCTTACTCGAGTAAGGCTTCCTTACAATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012039.1-771s21c1
Sequence:CCGGGCTGAAGTCATTTGGTCAGATCTCGAGATCTGACCAAATGACTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012039.1-771s1c1
Sequence:CCGGGCTGAAGTCATTTGGTCAGATCTCGAGATCTGACCAAATGACTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098185    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012039.1-2489s1c1
Sequence:CCGGCCAGTATATCATGGAAGCGTACTCGAGTACGCTTCCATGATATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012039.1-1330s1c1
Sequence:CCGGCCCGATTGTAAGGAAGCCTTACTCGAGTAAGGCTTCCTTACAATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012039.1-1225s1c1
Sequence:CCGGGCTCGCAATATCAATTCTCATCTCGAGATGAGAATTGATATTGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012039.1-2075s1c1
Sequence:CCGGCGACTGAAGATGGTGATAGATCTCGAGATCTATCACCATCTTCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks