EMAIL THIS PAGE TO A FRIEND

ZWILCH

zwilch kinetochore protein

Synonyms: KNTC1AP hZwilch
UniProtKB ID: Q9H900, B3KVB8, Q6N049, Q8N404, Q96SY7, Q9NWG7
Gene ID:
Mouse(68014) zwilch kinetochore protein
Rat(691493) zwilch kinetochore protein
fruit fly(59247) CG18729 gene product from transcript CG18729-RA
chicken(415552) Zwilch, kinetochore associated, homolog (Drosophila)
Horse(100053053) Zwilch, kinetochore associated, homolog (Drosophila)
domestic cat(101080893) Zwilch, kinetochore associated, homolog (Drosophila)
Zebrafish(336439) Zwilch, kinetochore associated, homolog (Drosophila)
dog(478349) Zwilch, kinetochore associated, homolog (Drosophila)
naked mole-rat(101711214) zwilch kinetochore protein
Domestic Rabbit(100347595) Zwilch, kinetochore associated, homolog (Drosophila)
domestic guinea pig(100735708) zwilch kinetochore protein
cow(534811) Zwilch, kinetochore associated, homolog (Drosophila)
sheep(101102815) Zwilch, kinetochore associated, homolog (Drosophila)
58 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026507 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026507 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026507 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017975 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017975 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017975 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017975 Rosetta Predictions human pricing
NR_003105 Rosetta Predictions human pricing
XM_001078534 Rosetta Predictions rat pricing
NM_026507 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017975 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351017 predicted 1676
2 SASI_Hs01_00101837 predicted 572
3 SASI_Hs01_00101838 predicted 564
4 SASI_Hs01_00101839 predicted 648
5 SASI_Hs01_00101840 predicted 1406
6 SASI_Hs01_00101842 predicted 1397
7 SASI_Hs01_00101843 predicted 595
8 SASI_Hs01_00101844 predicted 492
9 SASI_Hs01_00101845 predicted 339
10 SASI_Hs01_00101846 predicted 1433
11 SASI_Hs01_00101841 predicted 421
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003105 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00378256 predicted 742
2 SASI_Hs02_00378257 predicted 1500
3 SASI_Hs02_00378258 predicted 2828
4 SASI_Hs02_00378259 predicted 2525
5 SASI_Hs02_00378260 predicted 694
6 SASI_Hs02_00378261 predicted 2621
7 SASI_Hs02_00378262 predicted 363
8 SASI_Hs02_00378263 predicted 907
9 SASI_Hs02_00378264 predicted 705
10 SASI_Hs02_00378265 predicted 2420
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078534 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00361169 predicted 322
2 SASI_Rn02_00361170 predicted 605
3 SASI_Rn02_00361171 predicted 577
4 SASI_Rn02_00361172 predicted 609
5 SASI_Rn02_00361173 predicted 751
6 SASI_Rn02_00361174 predicted 416
7 SASI_Rn02_00361175 predicted 361
8 SASI_Rn02_00361176 predicted 496
9 SASI_Rn02_00361177 predicted 903
10 SASI_Rn02_00361178 predicted 469
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026507 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00078073 predicted 534
2 SASI_Mm01_00078074 predicted 381
3 SASI_Mm01_00078075 predicted 858
4 SASI_Mm01_00078076 predicted 1102
5 SASI_Mm01_00078077 predicted 1162
6 SASI_Mm01_00078078 predicted 550
7 SASI_Mm01_00078079 predicted 515
8 SASI_Mm01_00078080 predicted 1768
9 SASI_Mm01_00078081 predicted 1310
10 SASI_Mm02_00330413 predicted 562
11 SASI_Mm01_00078082 predicted 987
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026507
VALIDATED
ZWILCH MISSION shRNA Bacterial Glycerol Stock
zwilch kinetochore protein
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201716    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026507.2-2466s1c1
Sequence:CCGGGCATGGCAGTACACACCTTTACTCGAGTAAAGGTGTGTACTGCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026507.2-1327s1c1
Sequence:CCGGGCATCTTTGAATCATTTGGAACTCGAGTTCCAAATGATTCAAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026507.2-466s1c1
Sequence:CCGGGCTGAGCTTATCACAACAAATCTCGAGATTTGTTGTGATAAGCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026507.2-516s1c1
Sequence:CCGGGCTCACTTGTAAAGCTGATAACTCGAGTTATCAGCTTTACAAGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298023    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026507.3-2518s21c1
Sequence:CCGGGCATGGCAGTACACACCTTTACTCGAGTAAAGGTGTGTACTGCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026507.3-568s21c1
Sequence:CCGGGCTCACTTGTAAAGCTGATAACTCGAGTTATCAGCTTTACAAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026507.3-1379s21c1
Sequence:CCGGGCATCTTTGAATCATTTGGAACTCGAGTTCCAAATGATTCAAAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026507.3-518s21c1
Sequence:CCGGGCTGAGCTTATCACAACAAATCTCGAGATTTGTTGTGATAAGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026507
VALIDATED
ZWILCH MISSION shRNA shRNA Plasmid DNA
zwilch kinetochore protein
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201716    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026507.2-2466s1c1
Sequence:CCGGGCATGGCAGTACACACCTTTACTCGAGTAAAGGTGTGTACTGCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026507.2-1327s1c1
Sequence:CCGGGCATCTTTGAATCATTTGGAACTCGAGTTCCAAATGATTCAAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026507.2-466s1c1
Sequence:CCGGGCTGAGCTTATCACAACAAATCTCGAGATTTGTTGTGATAAGCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026507.2-516s1c1
Sequence:CCGGGCTCACTTGTAAAGCTGATAACTCGAGTTATCAGCTTTACAAGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298023    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026507.3-2518s21c1
Sequence:CCGGGCATGGCAGTACACACCTTTACTCGAGTAAAGGTGTGTACTGCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026507.3-568s21c1
Sequence:CCGGGCTCACTTGTAAAGCTGATAACTCGAGTTATCAGCTTTACAAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026507.3-1379s21c1
Sequence:CCGGGCATCTTTGAATCATTTGGAACTCGAGTTCCAAATGATTCAAAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026507.3-518s21c1
Sequence:CCGGGCTGAGCTTATCACAACAAATCTCGAGATTTGTTGTGATAAGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026507
VALIDATED
ZWILCH MISSION shRNA Lentiviral Transduction Particles
zwilch kinetochore protein
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201716    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026507.2-2466s1c1
Sequence:CCGGGCATGGCAGTACACACCTTTACTCGAGTAAAGGTGTGTACTGCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026507.2-1327s1c1
Sequence:CCGGGCATCTTTGAATCATTTGGAACTCGAGTTCCAAATGATTCAAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026507.2-466s1c1
Sequence:CCGGGCTGAGCTTATCACAACAAATCTCGAGATTTGTTGTGATAAGCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026507.2-516s1c1
Sequence:CCGGGCTCACTTGTAAAGCTGATAACTCGAGTTATCAGCTTTACAAGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298023    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026507.3-2518s21c1
Sequence:CCGGGCATGGCAGTACACACCTTTACTCGAGTAAAGGTGTGTACTGCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026507.3-568s21c1
Sequence:CCGGGCTCACTTGTAAAGCTGATAACTCGAGTTATCAGCTTTACAAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026507.3-1379s21c1
Sequence:CCGGGCATCTTTGAATCATTTGGAACTCGAGTTCCAAATGATTCAAAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026507.3-518s21c1
Sequence:CCGGGCTGAGCTTATCACAACAAATCTCGAGATTTGTTGTGATAAGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017975
VALIDATED
ZWILCH MISSION shRNA Bacterial Glycerol Stock
zwilch kinetochore protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017975.2-2437s1c1
Sequence:CCGGGCCATGAAATAGAACTTAGTACTCGAGTACTAAGTTCTATTTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017975.2-1940s1c1
Sequence:CCGGCGGAATTAACACTAAACGGTACTCGAGTACCGTTTAGTGTTAATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017975.2-1419s1c1
Sequence:CCGGCAGTTTACTAAGTAAGCTCATCTCGAGATGAGCTTACTTAGTAAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017975.2-867s1c1
Sequence:CCGGGCTCTTTAAGTCCTCTGCCTTCTCGAGAAGGCAGAGGACTTAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017975.2-1962s1c1
Sequence:CCGGCCTGGAAGAAAGGATATTCTTCTCGAGAAGAATATCCTTTCTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017975.3-915s21c1
Sequence:CCGGTGCGATCGCTTTGGATATTTCCTCGAGGAAATATCCAAAGCGATCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017975.3-1566s21c1
Sequence:CCGGACTTGCATCTTTGAATCATTTCTCGAGAAATGATTCAAAGATGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289548    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_017975.3-2437s21c1
Sequence:CCGGGCCATGAAATAGAACTTAGTACTCGAGTACTAAGTTCTATTTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017975.3-1962s21c1
Sequence:CCGGCCTGGAAGAAAGGATATTCTTCTCGAGAAGAATATCCTTTCTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017975.3-1419s21c1
Sequence:CCGGCAGTTTACTAAGTAAGCTCATCTCGAGATGAGCTTACTTAGTAAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017975
VALIDATED
ZWILCH MISSION shRNA shRNA Plasmid DNA
zwilch kinetochore protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017975.2-2437s1c1
Sequence:CCGGGCCATGAAATAGAACTTAGTACTCGAGTACTAAGTTCTATTTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017975.2-1940s1c1
Sequence:CCGGCGGAATTAACACTAAACGGTACTCGAGTACCGTTTAGTGTTAATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017975.2-1419s1c1
Sequence:CCGGCAGTTTACTAAGTAAGCTCATCTCGAGATGAGCTTACTTAGTAAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017975.2-867s1c1
Sequence:CCGGGCTCTTTAAGTCCTCTGCCTTCTCGAGAAGGCAGAGGACTTAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017975.2-1962s1c1
Sequence:CCGGCCTGGAAGAAAGGATATTCTTCTCGAGAAGAATATCCTTTCTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017975.3-915s21c1
Sequence:CCGGTGCGATCGCTTTGGATATTTCCTCGAGGAAATATCCAAAGCGATCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017975.3-1566s21c1
Sequence:CCGGACTTGCATCTTTGAATCATTTCTCGAGAAATGATTCAAAGATGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289548    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_017975.3-2437s21c1
Sequence:CCGGGCCATGAAATAGAACTTAGTACTCGAGTACTAAGTTCTATTTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017975.3-1962s21c1
Sequence:CCGGCCTGGAAGAAAGGATATTCTTCTCGAGAAGAATATCCTTTCTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017975.3-1419s21c1
Sequence:CCGGCAGTTTACTAAGTAAGCTCATCTCGAGATGAGCTTACTTAGTAAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017975
VALIDATED
ZWILCH MISSION shRNA Lentiviral Transduction Particles
zwilch kinetochore protein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017975.2-2437s1c1
Sequence:CCGGGCCATGAAATAGAACTTAGTACTCGAGTACTAAGTTCTATTTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017975.2-1940s1c1
Sequence:CCGGCGGAATTAACACTAAACGGTACTCGAGTACCGTTTAGTGTTAATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017975.2-1419s1c1
Sequence:CCGGCAGTTTACTAAGTAAGCTCATCTCGAGATGAGCTTACTTAGTAAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017975.2-867s1c1
Sequence:CCGGGCTCTTTAAGTCCTCTGCCTTCTCGAGAAGGCAGAGGACTTAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017975.2-1962s1c1
Sequence:CCGGCCTGGAAGAAAGGATATTCTTCTCGAGAAGAATATCCTTTCTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017975.3-915s21c1
Sequence:CCGGTGCGATCGCTTTGGATATTTCCTCGAGGAAATATCCAAAGCGATCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017975.3-1566s21c1
Sequence:CCGGACTTGCATCTTTGAATCATTTCTCGAGAAATGATTCAAAGATGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289548    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_017975.3-2437s21c1
Sequence:CCGGGCCATGAAATAGAACTTAGTACTCGAGTACTAAGTTCTATTTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017975.3-1962s21c1
Sequence:CCGGCCTGGAAGAAAGGATATTCTTCTCGAGAAGAATATCCTTTCTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017975.3-1419s21c1
Sequence:CCGGCAGTTTACTAAGTAAGCTCATCTCGAGATGAGCTTACTTAGTAAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks