EMAIL THIS PAGE TO A FRIEND

ZWINT

ZW10 interacting kinetochore protein

Synonyms: HZwint-1 KNTC2AP ZWINT1
UniProtKB ID: O95229, A6NNV6, Q0D2I3, Q9BWD0
Gene ID:
Human(11130) Summary: This gene encodes a protein that is clearly involved in kinetochore function although an exact role is not known. It interacts with ZW10, another kinetochore protein, possibly regulating the association between ZW10 and kinetochores. The encoded protein localizes to prophase kinetochores before ZW10 does and it remains detectable on the kinetochore until late anaphase. It has a uniform distribution in the cytoplasm of interphase cells. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(52696) ZW10 interactor
Rat(257644) ZW10 interactor, kinetochore protein
cow(514564) ZW10 interactor
sheep(101115332) ZW10 interactor
domestic guinea pig(100733430) ZW10 interacting kinetochore protein
dog(477579) ZW10 interactor
133 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025635 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025635 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025635 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007057 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007057 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007057 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005413 Rosetta Predictions human pricing
NM_001005414 Rosetta Predictions human pricing
NM_007057 Rosetta Predictions human pricing
NM_032997 Rosetta Predictions human pricing
NM_147138 Rosetta Predictions rat pricing
NM_025635 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005413 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00304910 predicted 294
2 SASI_Hs02_00304911 predicted 298
3 SASI_Hs02_00304912 predicted 240
4 SASI_Hs02_00304913 predicted 210
5 SASI_Hs01_00053677 predicted 972
6 SASI_Hs02_00304914 predicted 295
7 SASI_Hs02_00304915 predicted 285
8 SASI_Hs02_00304916 predicted 287
9 SASI_Hs02_00304917 predicted 237
10 SASI_Hs02_00304918 predicted 300
11 SASI_Hs01_00053670 predicted 1051
12 SASI_Hs01_00053671 predicted 1053
13 SASI_Hs01_00053672 predicted 1030
14 SASI_Hs01_00053673 predicted 1034
15 SASI_Hs01_00053674 predicted 1043
16 SASI_Hs01_00053675 predicted 1042
17 SASI_Hs01_00053676 predicted 1057
18 SASI_Hs01_00053678 predicted 1028
19 SASI_Hs01_00053679 predicted 1041
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005414 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100491 predicted 142
2 SASI_Hs01_00100492 predicted 276
3 SASI_Hs01_00100493 predicted 616
4 SASI_Hs01_00100494 predicted 664
5 SASI_Hs01_00100495 predicted 261
6 SASI_Hs01_00100496 predicted 67
7 SASI_Hs01_00100497 predicted 161
8 SASI_Hs01_00100498 predicted 650
9 SASI_Hs01_00100499 predicted 485
10 SASI_Hs01_00100500 predicted 465
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007057 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00342864 predicted 296
2 SASI_Hs01_00048594 predicted 299
3 SASI_Hs02_00342865 predicted 237
4 SASI_Hs02_00342866 predicted 209
5 SASI_Hs01_00048590 predicted 1112
6 SASI_Hs02_00342867 predicted 291
7 SASI_Hs02_00342868 predicted 291
8 SASI_Hs02_00342869 predicted 285
9 SASI_Hs02_00342870 predicted 234
10 SASI_Hs02_00342871 predicted 301
11 SASI_Hs01_00048591 predicted 1123
12 SASI_Hs01_00048592 predicted 1117
13 SASI_Hs01_00048593 predicted 1120
14 SASI_Hs01_00048595 predicted 1079
15 SASI_Hs01_00048596 predicted 149
16 SASI_Hs01_00048597 predicted 1076
17 SASI_Hs01_00048598 predicted 587
18 SASI_Hs01_00048599 predicted 1039
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032997 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00360637 predicted 294
2 SASI_Hs01_00066261 predicted 297
3 SASI_Hs02_00360638 predicted 239
4 SASI_Hs02_00360639 predicted 204
5 SASI_Hs01_00066257 predicted 1306
6 SASI_Hs02_00360640 predicted 288
7 SASI_Hs02_00360641 predicted 291
8 SASI_Hs02_00360642 predicted 288
9 SASI_Hs02_00360643 predicted 231
10 SASI_Hs02_00360644 predicted 300
11 SASI_Hs01_00066258 predicted 1313
12 SASI_Hs01_00066259 predicted 1308
13 SASI_Hs01_00066260 predicted 1312
14 SASI_Hs01_00066262 predicted 1274
15 SASI_Hs01_00066263 predicted 142
16 SASI_Hs01_00066264 predicted 1269
17 SASI_Hs01_00066265 predicted 588
18 SASI_Hs01_00066266 predicted 1233
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147138 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00268833 predicted 212
2 SASI_Rn01_00120965 predicted 241
3 SASI_Rn01_00120969 predicted 874
4 SASI_Rn01_00120972 predicted 805
5 SASI_Rn01_00120973 predicted 499
6 SASI_Rn01_00120974 predicted 496
7 SASI_Rn02_00268834 predicted 720
8 SASI_Rn02_00268835 predicted 643
9 SASI_Rn02_00268836 predicted 806
10 SASI_Rn02_00268837 predicted 614
11 SASI_Rn01_00120966 predicted 567
12 SASI_Rn01_00120967 predicted 466
13 SASI_Rn01_00120968 predicted 408
14 SASI_Rn01_00120970 predicted 308
15 SASI_Rn01_00120971 predicted 568
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025635 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00328704 predicted 1284
2 SASI_Mm02_00328705 predicted 737
3 SASI_Mm02_00328706 predicted 866
4 SASI_Mm02_00328707 predicted 823
5 SASI_Mm02_00328708 predicted 1184
6 SASI_Mm02_00328709 predicted 1161
7 SASI_Mm02_00328710 predicted 1242
8 SASI_Mm02_00328711 predicted 1146
9 SASI_Mm02_00328712 predicted 1212
10 SASI_Mm02_00328713 predicted 1218
11 SASI_Mm01_00164635 predicted 858
12 SASI_Mm01_00164636 predicted 946
13 SASI_Mm01_00164637 predicted 952
14 SASI_Mm01_00164638 predicted 961
15 SASI_Mm01_00164639 predicted 1044
16 SASI_Mm01_00164640 predicted 963
17 SASI_Mm01_00164641 predicted 994
18 SASI_Mm01_00164642 predicted 885
19 SASI_Mm01_00164643 predicted 887
20 SASI_Mm01_00164644 predicted 777
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025635
VALIDATED
ZWINT MISSION shRNA Bacterial Glycerol Stock
ZW10 interacting kinetochore protein
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000443989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025635.3-166s21c1
Sequence:CCGGTTTATGAGGAACTCGCGGAAGCTCGAGCTTCCGCGAGTTCCTCATAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433995    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025635.3-1198s21c1
Sequence:CCGGAGATTAGACCAGGGATGATAGCTCGAGCTATCATCCCTGGTCTAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025635.3-534s21c1
Sequence:CCGGGAACCTGACAAAGATTTCTGCCTCGAGGCAGAAATCTTTGTCAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434723    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025635.3-1147s21c1
Sequence:CCGGGAGAAGCTTTGAGTCTATAAACTCGAGTTTATAGACTCAAAGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025635.3-510s21c1
Sequence:CCCGGGTACTGCAACAGAAGCGTTTCTCGAGAAACGCTTCTGTTGCAGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025635.3-174s21c1
Sequence:CCGGGAACTCGCGGAAGAAAGACAACTCGAGTTGTCTTTCTTCCGCGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125654    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025635.1-1523s1c1
Sequence:CCGGCCTCAATTAGACTGGCAGTTTCTCGAGAAACTGCCAGTCTAATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025635.1-132s1c1
Sequence:CCGGGCCAAGATCATGGAGGAGTTTCTCGAGAAACTCCTCCATGATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025635.1-711s1c1
Sequence:CCGGGCTGAGGACAAAGATGTGAAACTCGAGTTTCACATCTTTGTCCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025635.1-453s1c1
Sequence:CCGGCGAGTCCTTGAGGAGAAACTTCTCGAGAAGTTTCTCCTCAAGGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025635.1-296s1c1
Sequence:CCGGTGAAACTAAGGAGCAGTGGAACTCGAGTTCCACTGCTCCTTAGTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025635
VALIDATED
ZWINT MISSION shRNA shRNA Plasmid DNA
ZW10 interacting kinetochore protein
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000443989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025635.3-166s21c1
Sequence:CCGGTTTATGAGGAACTCGCGGAAGCTCGAGCTTCCGCGAGTTCCTCATAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433995    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025635.3-1198s21c1
Sequence:CCGGAGATTAGACCAGGGATGATAGCTCGAGCTATCATCCCTGGTCTAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025635.3-534s21c1
Sequence:CCGGGAACCTGACAAAGATTTCTGCCTCGAGGCAGAAATCTTTGTCAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434723    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025635.3-1147s21c1
Sequence:CCGGGAGAAGCTTTGAGTCTATAAACTCGAGTTTATAGACTCAAAGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025635.3-510s21c1
Sequence:CCCGGGTACTGCAACAGAAGCGTTTCTCGAGAAACGCTTCTGTTGCAGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025635.3-174s21c1
Sequence:CCGGGAACTCGCGGAAGAAAGACAACTCGAGTTGTCTTTCTTCCGCGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125654    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025635.1-1523s1c1
Sequence:CCGGCCTCAATTAGACTGGCAGTTTCTCGAGAAACTGCCAGTCTAATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025635.1-132s1c1
Sequence:CCGGGCCAAGATCATGGAGGAGTTTCTCGAGAAACTCCTCCATGATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025635.1-711s1c1
Sequence:CCGGGCTGAGGACAAAGATGTGAAACTCGAGTTTCACATCTTTGTCCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025635.1-453s1c1
Sequence:CCGGCGAGTCCTTGAGGAGAAACTTCTCGAGAAGTTTCTCCTCAAGGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025635.1-296s1c1
Sequence:CCGGTGAAACTAAGGAGCAGTGGAACTCGAGTTCCACTGCTCCTTAGTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025635
VALIDATED
ZWINT MISSION shRNA Lentiviral Transduction Particles
ZW10 interacting kinetochore protein
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000443989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025635.3-166s21c1
Sequence:CCGGTTTATGAGGAACTCGCGGAAGCTCGAGCTTCCGCGAGTTCCTCATAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433995    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025635.3-1198s21c1
Sequence:CCGGAGATTAGACCAGGGATGATAGCTCGAGCTATCATCCCTGGTCTAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025635.3-534s21c1
Sequence:CCGGGAACCTGACAAAGATTTCTGCCTCGAGGCAGAAATCTTTGTCAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434723    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025635.3-1147s21c1
Sequence:CCGGGAGAAGCTTTGAGTCTATAAACTCGAGTTTATAGACTCAAAGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025635.3-510s21c1
Sequence:CCCGGGTACTGCAACAGAAGCGTTTCTCGAGAAACGCTTCTGTTGCAGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025635.3-174s21c1
Sequence:CCGGGAACTCGCGGAAGAAAGACAACTCGAGTTGTCTTTCTTCCGCGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125654    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025635.1-1523s1c1
Sequence:CCGGCCTCAATTAGACTGGCAGTTTCTCGAGAAACTGCCAGTCTAATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025635.1-132s1c1
Sequence:CCGGGCCAAGATCATGGAGGAGTTTCTCGAGAAACTCCTCCATGATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025635.1-711s1c1
Sequence:CCGGGCTGAGGACAAAGATGTGAAACTCGAGTTTCACATCTTTGTCCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025635.1-453s1c1
Sequence:CCGGCGAGTCCTTGAGGAGAAACTTCTCGAGAAGTTTCTCCTCAAGGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025635.1-296s1c1
Sequence:CCGGTGAAACTAAGGAGCAGTGGAACTCGAGTTCCACTGCTCCTTAGTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007057
VALIDATED
ZWINT MISSION shRNA Bacterial Glycerol Stock
ZW10 interacting kinetochore protein
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380371    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007057.3-1003s21c1
Sequence:GTACCGGCTCTGGCATCTGTGGATTAAACTCGAGTTTAATCCACAGATGCCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379699    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007057.3-926s21c1
Sequence:GTACCGGCTCACCTCCCAACCATCATTACTCGAGTAATGATGGTTGGGAGGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007057.3-839s21c1
Sequence:CCGGCTACAACCTGCTGGAGATGTACTCGAGTACATCTCCAGCAGGTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007057.3-732s21c1
Sequence:CCGGCAGAGAATCTTCCAGATGATACTCGAGTATCATCTGGAAGATTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007057.3-303s21c1
Sequence:CCGGCAATTGCAGCTAAGGAACAATCTCGAGATTGTTCCTTAGCTGCAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007057.3-160s21c1
Sequence:CCGGGTTTGTGGTGGACTCTCAGAACTCGAGTTCTGAGAGTCCACCACAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007057.3-143s21c1
Sequence:CCGGGCCAAGATCCTGGTTGAGTTTCTCGAGAAACTCAACCAGGATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007057.2-826s1c1
Sequence:CCGGCTACAACCTGCTGGAGATGTACTCGAGTACATCTCCAGCAGGTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150840    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007057.2-588s1c1
Sequence:CCGGGTTTCAGAAACTTGGAAACCTCTCGAGAGGTTTCCAAGTTTCTGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_007057.2-719s1c1
Sequence:CCGGCAGAGAATCTTCCAGATGATACTCGAGTATCATCTGGAAGATTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007057.2-147s1c1
Sequence:CCGGGTTTGTGGTGGACTCTCAGAACTCGAGTTCTGAGAGTCCACCACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007057.2-290s1c1
Sequence:CCGGCAATTGCAGCTAAGGAACAATCTCGAGATTGTTCCTTAGCTGCAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154529    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007057.2-135s1c1
Sequence:CCGGGATCCTGGTTGAGTTTGTGGTCTCGAGACCACAAACTCAACCAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007057.2-130s1c1
Sequence:CCGGGCCAAGATCCTGGTTGAGTTTCTCGAGAAACTCAACCAGGATCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007057
VALIDATED
ZWINT MISSION shRNA shRNA Plasmid DNA
ZW10 interacting kinetochore protein
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380371    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007057.3-1003s21c1
Sequence:GTACCGGCTCTGGCATCTGTGGATTAAACTCGAGTTTAATCCACAGATGCCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379699    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007057.3-926s21c1
Sequence:GTACCGGCTCACCTCCCAACCATCATTACTCGAGTAATGATGGTTGGGAGGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007057.3-839s21c1
Sequence:CCGGCTACAACCTGCTGGAGATGTACTCGAGTACATCTCCAGCAGGTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007057.3-732s21c1
Sequence:CCGGCAGAGAATCTTCCAGATGATACTCGAGTATCATCTGGAAGATTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007057.3-303s21c1
Sequence:CCGGCAATTGCAGCTAAGGAACAATCTCGAGATTGTTCCTTAGCTGCAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007057.3-160s21c1
Sequence:CCGGGTTTGTGGTGGACTCTCAGAACTCGAGTTCTGAGAGTCCACCACAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007057.3-143s21c1
Sequence:CCGGGCCAAGATCCTGGTTGAGTTTCTCGAGAAACTCAACCAGGATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007057.2-826s1c1
Sequence:CCGGCTACAACCTGCTGGAGATGTACTCGAGTACATCTCCAGCAGGTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150840    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007057.2-588s1c1
Sequence:CCGGGTTTCAGAAACTTGGAAACCTCTCGAGAGGTTTCCAAGTTTCTGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_007057.2-719s1c1
Sequence:CCGGCAGAGAATCTTCCAGATGATACTCGAGTATCATCTGGAAGATTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007057.2-147s1c1
Sequence:CCGGGTTTGTGGTGGACTCTCAGAACTCGAGTTCTGAGAGTCCACCACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007057.2-290s1c1
Sequence:CCGGCAATTGCAGCTAAGGAACAATCTCGAGATTGTTCCTTAGCTGCAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154529    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007057.2-135s1c1
Sequence:CCGGGATCCTGGTTGAGTTTGTGGTCTCGAGACCACAAACTCAACCAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007057.2-130s1c1
Sequence:CCGGGCCAAGATCCTGGTTGAGTTTCTCGAGAAACTCAACCAGGATCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007057
VALIDATED
ZWINT MISSION shRNA Lentiviral Transduction Particles
ZW10 interacting kinetochore protein
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380371    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007057.3-1003s21c1
Sequence:GTACCGGCTCTGGCATCTGTGGATTAAACTCGAGTTTAATCCACAGATGCCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379699    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007057.3-926s21c1
Sequence:GTACCGGCTCACCTCCCAACCATCATTACTCGAGTAATGATGGTTGGGAGGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007057.3-839s21c1
Sequence:CCGGCTACAACCTGCTGGAGATGTACTCGAGTACATCTCCAGCAGGTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007057.3-732s21c1
Sequence:CCGGCAGAGAATCTTCCAGATGATACTCGAGTATCATCTGGAAGATTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007057.3-303s21c1
Sequence:CCGGCAATTGCAGCTAAGGAACAATCTCGAGATTGTTCCTTAGCTGCAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007057.3-160s21c1
Sequence:CCGGGTTTGTGGTGGACTCTCAGAACTCGAGTTCTGAGAGTCCACCACAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007057.3-143s21c1
Sequence:CCGGGCCAAGATCCTGGTTGAGTTTCTCGAGAAACTCAACCAGGATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007057.2-826s1c1
Sequence:CCGGCTACAACCTGCTGGAGATGTACTCGAGTACATCTCCAGCAGGTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150840    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007057.2-588s1c1
Sequence:CCGGGTTTCAGAAACTTGGAAACCTCTCGAGAGGTTTCCAAGTTTCTGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_007057.2-719s1c1
Sequence:CCGGCAGAGAATCTTCCAGATGATACTCGAGTATCATCTGGAAGATTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007057.2-147s1c1
Sequence:CCGGGTTTGTGGTGGACTCTCAGAACTCGAGTTCTGAGAGTCCACCACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007057.2-290s1c1
Sequence:CCGGCAATTGCAGCTAAGGAACAATCTCGAGATTGTTCCTTAGCTGCAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154529    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007057.2-135s1c1
Sequence:CCGGGATCCTGGTTGAGTTTGTGGTCTCGAGACCACAAACTCAACCAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007057.2-130s1c1
Sequence:CCGGGCCAAGATCCTGGTTGAGTTTCTCGAGAAACTCAACCAGGATCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks