EMAIL THIS PAGE TO A FRIEND

ZXDA

zinc finger, X-linked, duplicated A

Synonyms: ZNF896
Species: Human ZXDA(7789), Mouse Zxda(668171)
UniProtKB ID: P98168, Q9UJP7
Gene ID:
Human(7789) Summary: This gene encodes one of two duplicated zinc finger genes on chromosome Xp11. This gene is the telomeric copy; GeneID 158586 ZXDB is the more centromeric copy. The two genes have 98% nucleotide sequence similarity, and the predicted proteins contain 10 tandem zinc finger motifs. [provided by RefSeq, Nov 2009]
Mouse(668171) zinc finger, X-linked, duplicated A
54 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007156 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007156 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007156 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007156 Rosetta Predictions human pricing
NR_003292 Rosetta Predictions mouse pricing
XR_002152 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007156 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00343069 predicted 2378
2 SASI_Hs02_00343070 predicted 2399
3 SASI_Hs02_00343071 predicted 1430
4 SASI_Hs02_00343072 predicted 2364
5 SASI_Hs02_00343073 predicted 2477
6 SASI_Hs02_00343074 predicted 2383
7 SASI_Hs02_00343075 predicted 2045
8 SASI_Hs02_00343076 predicted 2078
9 SASI_Hs02_00343077 predicted 1884
10 SASI_Hs02_00343078 predicted 1796
11 SASI_Hs01_00181411 predicted 2621
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003292 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00353276 predicted 6262
2 SASI_Mm02_00353277 predicted 5143
3 SASI_Mm02_00353278 predicted 5278
4 SASI_Mm02_00353279 predicted 3861
5 SASI_Mm02_00353280 predicted 4989
6 SASI_Mm02_00353281 predicted 3841
7 SASI_Mm02_00353282 predicted 4622
8 SASI_Mm02_00353283 predicted 6173
9 SASI_Mm02_00353284 predicted 4965
10 SASI_Mm02_00353285 predicted 5728
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_002152 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00214088 predicted 5217
2 SASI_Mm01_00214089 predicted 4847
3 SASI_Mm01_00214090 predicted 5352
4 SASI_Mm01_00214091 predicted 3943
5 SASI_Mm01_00214092 predicted 5067
6 SASI_Mm01_00214093 predicted 3919
7 SASI_Mm01_00214094 predicted 4692
8 SASI_Mm01_00214095 predicted 5544
9 SASI_Mm01_00214096 predicted 5044
10 SASI_Mm01_00214097 predicted 5203
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007156
ZXDA MISSION shRNA Bacterial Glycerol Stock
zinc finger, X-linked, duplicated A
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117787    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007156.3-2630s1c1
Sequence:CCGGCCTTGCCATGTGGCTAACTTTCTCGAGAAAGTTAGCCACATGGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007156.3-1939s1c1
Sequence:CCGGGCTCAGCTAGAAGCAGCAAATCTCGAGATTTGCTGCTTCTAGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007156.3-1496s1c1
Sequence:CCGGGCAAGCAATATGACAAGGCTTCTCGAGAAGCCTTGTCATATTGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007156.3-2142s1c1
Sequence:CCGGCCTCCCTGCTAATAATAATAACTCGAGTTATTATTATTAGCAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007156.3-2481s1c1
Sequence:CCGGCGTACATCCTAACTCTGACTTCTCGAGAAGTCAGAGTTAGGATGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007156.4-2569s21c1
Sequence:CCGGGAAAGAAATCTTATCACTGTGCTCGAGCACAGTGATAAGATTTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421520    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007156.4-2740s21c1
Sequence:CCGGATGAGTTTGGAGATCTAAATTCTCGAGAATTTAGATCTCCAAACTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414416    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007156.4-2854s21c1
Sequence:CCGGGTTTGAACACATTGCTCATAACTCGAGTTATGAGCAATGTGTTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007156
ZXDA MISSION shRNA shRNA Plasmid DNA
zinc finger, X-linked, duplicated A
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117787    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007156.3-2630s1c1
Sequence:CCGGCCTTGCCATGTGGCTAACTTTCTCGAGAAAGTTAGCCACATGGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007156.3-1939s1c1
Sequence:CCGGGCTCAGCTAGAAGCAGCAAATCTCGAGATTTGCTGCTTCTAGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007156.3-1496s1c1
Sequence:CCGGGCAAGCAATATGACAAGGCTTCTCGAGAAGCCTTGTCATATTGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007156.3-2142s1c1
Sequence:CCGGCCTCCCTGCTAATAATAATAACTCGAGTTATTATTATTAGCAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007156.3-2481s1c1
Sequence:CCGGCGTACATCCTAACTCTGACTTCTCGAGAAGTCAGAGTTAGGATGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007156.4-2569s21c1
Sequence:CCGGGAAAGAAATCTTATCACTGTGCTCGAGCACAGTGATAAGATTTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421520    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007156.4-2740s21c1
Sequence:CCGGATGAGTTTGGAGATCTAAATTCTCGAGAATTTAGATCTCCAAACTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414416    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007156.4-2854s21c1
Sequence:CCGGGTTTGAACACATTGCTCATAACTCGAGTTATGAGCAATGTGTTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007156
ZXDA MISSION shRNA Lentiviral Transduction Particles
zinc finger, X-linked, duplicated A
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117787    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007156.3-2630s1c1
Sequence:CCGGCCTTGCCATGTGGCTAACTTTCTCGAGAAAGTTAGCCACATGGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007156.3-1939s1c1
Sequence:CCGGGCTCAGCTAGAAGCAGCAAATCTCGAGATTTGCTGCTTCTAGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007156.3-1496s1c1
Sequence:CCGGGCAAGCAATATGACAAGGCTTCTCGAGAAGCCTTGTCATATTGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007156.3-2142s1c1
Sequence:CCGGCCTCCCTGCTAATAATAATAACTCGAGTTATTATTATTAGCAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007156.3-2481s1c1
Sequence:CCGGCGTACATCCTAACTCTGACTTCTCGAGAAGTCAGAGTTAGGATGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007156.4-2569s21c1
Sequence:CCGGGAAAGAAATCTTATCACTGTGCTCGAGCACAGTGATAAGATTTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421520    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007156.4-2740s21c1
Sequence:CCGGATGAGTTTGGAGATCTAAATTCTCGAGAATTTAGATCTCCAAACTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414416    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007156.4-2854s21c1
Sequence:CCGGGTTTGAACACATTGCTCATAACTCGAGTTATGAGCAATGTGTTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks