EMAIL THIS PAGE TO A FRIEND

ZXDB

zinc finger, X-linked, duplicated B

Synonyms: ZNF905 dJ83L6.1
UniProtKB ID: P98169, A8K151, Q9UBB3
Gene ID:
Human(158586) Summary: The ZXDB gene is one of a pair of duplicated zinc finger genes on chromosome Xp11.21 (Greig et al., 1993 [PubMed 8268913]
Mouse(668166) zinc finger, X-linked, duplicated B
Rat(314119) zinc finger, X-linked, duplicated B
cow(783265) zinc finger, X-linked, duplicated B
Domestic Rabbit(100348852) zinc finger, X-linked, duplicated B
domestic cat(101098361) zinc finger, X-linked, duplicated B
Horse(100146995) zinc finger, X-linked, duplicated B
dog(491912) zinc finger, X-linked, duplicated B
209 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA043789 Anti-ZXDA antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007157 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007157 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007157 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081473 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081473 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081473 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007157 Rosetta Predictions human pricing
XM_234140 Rosetta Predictions rat pricing
NM_001081473 Rosetta Predictions mouse pricing
XR_002151 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007157 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00343079 predicted 2410
2 SASI_Hs02_00343080 predicted 2385
3 SASI_Hs01_00146053 predicted 2468
4 SASI_Hs02_00343081 predicted 1443
5 SASI_Hs02_00343082 predicted 2372
6 SASI_Hs02_00343083 predicted 2055
7 SASI_Hs02_00343084 predicted 2090
8 SASI_Hs02_00343085 predicted 1895
9 SASI_Hs02_00343086 predicted 1812
10 SASI_Hs02_00343087 predicted 2027
11 SASI_Hs01_00146054 predicted 2576
12 SASI_Hs01_00146055 predicted 2642
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_234140 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00388314 predicted 447
2 SASI_Rn02_00388315 predicted 612
3 SASI_Rn02_00388316 predicted 512
4 SASI_Rn02_00388317 predicted 608
5 SASI_Rn02_00388318 predicted 617
6 SASI_Rn02_00388319 predicted 519
7 SASI_Rn02_00388320 predicted 466
8 SASI_Rn02_00388321 predicted 513
9 SASI_Rn02_00388322 predicted 429
10 SASI_Rn02_00388323 predicted 449
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081473 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298570 predicted 1702
2 SASI_Mm02_00298571 predicted 2247
3 SASI_Mm02_00298572 predicted 2211
4 SASI_Mm02_00298573 predicted 1547
5 SASI_Mm02_00298574 predicted 3036
6 SASI_Mm02_00298575 predicted 3085
7 SASI_Mm02_00298576 predicted 2992
8 SASI_Mm02_00298577 predicted 2047
9 SASI_Mm02_00298578 predicted 1385
10 SASI_Mm02_00298579 predicted 2366
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_002151 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00282043 predicted 4502
2 SASI_Mm01_00282044 predicted 4033
3 SASI_Mm01_00282045 predicted 4273
4 SASI_Mm01_00282046 predicted 4375
5 SASI_Mm01_00282047 predicted 4615
6 SASI_Mm01_00282048 predicted 2949
7 SASI_Mm01_00282049 predicted 3287
8 SASI_Mm01_00282050 predicted 4777
9 SASI_Mm01_00282051 predicted 4403
10 SASI_Mm01_00282052 predicted 4082
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007157
VALIDATED
ZXDB MISSION shRNA Bacterial Glycerol Stock
zinc finger, X-linked, duplicated B
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241579    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007157.3-3345s21c1
Sequence:CCGGATTAGTAGAATCCCGTAAATCCTCGAGGATTTACGGGATTCTACTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241580    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007157.3-4167s21c1
Sequence:CCGGGACAATAATTGGAGTAGTTTACTCGAGTAAACTACTCCAATTATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241582    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007157.3-3613s21c1
Sequence:CCGGATTTAGTAGGTGGCGCATAATCTCGAGATTATGCGCCACCTACTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241583    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007157.3-3238s21c1
Sequence:CCGGCCATTATCGCAAGTGATATTTCTCGAGAAATATCACTTGCGATAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241581    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007157.3-3482s21c1
Sequence:CCGGTAATTGCATCCCTATGGTAATCTCGAGATTACCATAGGGATGCAATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007157.3-2288s1c1
Sequence:CCGGCCTTAAATATGGATGAGGTCTCTCGAGAGACCTCATCCATATTTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007157.3-2327s1c1
Sequence:CCGGCATTGGGATCTCTGGACTCTTCTCGAGAAGAGTCCAGAGATCCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139571    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007157.3-1563s1c1
Sequence:CCGGCGAGAGACCTTTCCTTTGTGACTCGAGTCACAAAGGAAAGGTCTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007157.3-1570s1c1
Sequence:CCGGCCTTTCCTTTGTGACTTTGATCTCGAGATCAAAGTCACAAAGGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007157.3-1239s1c1
Sequence:CCGGCAAGAGCTTCACCACAGTGTACTCGAGTACACTGTGGTGAAGCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_007157.3-1803s1c1
Sequence:CCGGCCTCTACATTCACTCCAAGAACTCGAGTTCTTGGAGTGAATGTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007157.3-1288s1c1
Sequence:CCGGGAGCAGGAGAACTCATTCAAACTCGAGTTTGAATGAGTTCTCCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007157
VALIDATED
ZXDB MISSION shRNA shRNA Plasmid DNA
zinc finger, X-linked, duplicated B
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241579    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007157.3-3345s21c1
Sequence:CCGGATTAGTAGAATCCCGTAAATCCTCGAGGATTTACGGGATTCTACTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241580    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007157.3-4167s21c1
Sequence:CCGGGACAATAATTGGAGTAGTTTACTCGAGTAAACTACTCCAATTATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241582    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007157.3-3613s21c1
Sequence:CCGGATTTAGTAGGTGGCGCATAATCTCGAGATTATGCGCCACCTACTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241583    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007157.3-3238s21c1
Sequence:CCGGCCATTATCGCAAGTGATATTTCTCGAGAAATATCACTTGCGATAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241581    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007157.3-3482s21c1
Sequence:CCGGTAATTGCATCCCTATGGTAATCTCGAGATTACCATAGGGATGCAATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007157.3-2288s1c1
Sequence:CCGGCCTTAAATATGGATGAGGTCTCTCGAGAGACCTCATCCATATTTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007157.3-2327s1c1
Sequence:CCGGCATTGGGATCTCTGGACTCTTCTCGAGAAGAGTCCAGAGATCCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139571    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007157.3-1563s1c1
Sequence:CCGGCGAGAGACCTTTCCTTTGTGACTCGAGTCACAAAGGAAAGGTCTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007157.3-1570s1c1
Sequence:CCGGCCTTTCCTTTGTGACTTTGATCTCGAGATCAAAGTCACAAAGGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007157.3-1239s1c1
Sequence:CCGGCAAGAGCTTCACCACAGTGTACTCGAGTACACTGTGGTGAAGCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_007157.3-1803s1c1
Sequence:CCGGCCTCTACATTCACTCCAAGAACTCGAGTTCTTGGAGTGAATGTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007157.3-1288s1c1
Sequence:CCGGGAGCAGGAGAACTCATTCAAACTCGAGTTTGAATGAGTTCTCCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007157
VALIDATED
ZXDB MISSION shRNA Lentiviral Transduction Particles
zinc finger, X-linked, duplicated B
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241579    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007157.3-3345s21c1
Sequence:CCGGATTAGTAGAATCCCGTAAATCCTCGAGGATTTACGGGATTCTACTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241580    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007157.3-4167s21c1
Sequence:CCGGGACAATAATTGGAGTAGTTTACTCGAGTAAACTACTCCAATTATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241582    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007157.3-3613s21c1
Sequence:CCGGATTTAGTAGGTGGCGCATAATCTCGAGATTATGCGCCACCTACTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241583    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007157.3-3238s21c1
Sequence:CCGGCCATTATCGCAAGTGATATTTCTCGAGAAATATCACTTGCGATAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241581    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007157.3-3482s21c1
Sequence:CCGGTAATTGCATCCCTATGGTAATCTCGAGATTACCATAGGGATGCAATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007157.3-2288s1c1
Sequence:CCGGCCTTAAATATGGATGAGGTCTCTCGAGAGACCTCATCCATATTTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007157.3-2327s1c1
Sequence:CCGGCATTGGGATCTCTGGACTCTTCTCGAGAAGAGTCCAGAGATCCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139571    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007157.3-1563s1c1
Sequence:CCGGCGAGAGACCTTTCCTTTGTGACTCGAGTCACAAAGGAAAGGTCTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007157.3-1570s1c1
Sequence:CCGGCCTTTCCTTTGTGACTTTGATCTCGAGATCAAAGTCACAAAGGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007157.3-1239s1c1
Sequence:CCGGCAAGAGCTTCACCACAGTGTACTCGAGTACACTGTGGTGAAGCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_007157.3-1803s1c1
Sequence:CCGGCCTCTACATTCACTCCAAGAACTCGAGTTCTTGGAGTGAATGTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007157.3-1288s1c1
Sequence:CCGGGAGCAGGAGAACTCATTCAAACTCGAGTTTGAATGAGTTCTCCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081473
ZXDB MISSION shRNA Bacterial Glycerol Stock
zinc finger, X-linked, duplicated B
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000240362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081473.1-1710s21c1
Sequence:CCGGCCAGCATGTCCAAGCTCTTAACTCGAGTTAAGAGCTTGGACATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081473.1-2199s21c1
Sequence:CCGGACTCTGGCATCTTGACTATTGCTCGAGCAATAGTCAAGATGCCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240365    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081473.1-4710s21c1
Sequence:CCGGTATGAGTGACAACTCTATATACTCGAGTATATAGAGTTGTCACTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081473.1-2678s21c1
Sequence:CCGGCAGAAAGACACAGATCTTATCCTCGAGGATAAGATCTGTGTCTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081473
ZXDB MISSION shRNA shRNA Plasmid DNA
zinc finger, X-linked, duplicated B
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000240362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081473.1-1710s21c1
Sequence:CCGGCCAGCATGTCCAAGCTCTTAACTCGAGTTAAGAGCTTGGACATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081473.1-2199s21c1
Sequence:CCGGACTCTGGCATCTTGACTATTGCTCGAGCAATAGTCAAGATGCCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240365    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081473.1-4710s21c1
Sequence:CCGGTATGAGTGACAACTCTATATACTCGAGTATATAGAGTTGTCACTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081473.1-2678s21c1
Sequence:CCGGCAGAAAGACACAGATCTTATCCTCGAGGATAAGATCTGTGTCTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081473
ZXDB MISSION shRNA Lentiviral Transduction Particles
zinc finger, X-linked, duplicated B
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000240362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081473.1-1710s21c1
Sequence:CCGGCCAGCATGTCCAAGCTCTTAACTCGAGTTAAGAGCTTGGACATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081473.1-2199s21c1
Sequence:CCGGACTCTGGCATCTTGACTATTGCTCGAGCAATAGTCAAGATGCCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240365    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081473.1-4710s21c1
Sequence:CCGGTATGAGTGACAACTCTATATACTCGAGTATATAGAGTTGTCACTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081473.1-2678s21c1
Sequence:CCGGCAGAAAGACACAGATCTTATCCTCGAGGATAAGATCTGTGTCTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks