EMAIL THIS PAGE TO A FRIEND

ZXDC

ZXD family zinc finger C

Synonyms: ZXDL
UniProtKB ID: Q2QGD7, C5J0H9, Q6DKI8, Q7L3L1, Q8NAU2
Gene ID:
Mouse(80292) ZXD family zinc finger C
Rat(362399) ZXD family zinc finger C
chicken(416034) ZXD family zinc finger C
dog(609097) ZXD family zinc finger C
domestic cat(101093342) ZXD family zinc finger C
naked mole-rat(101705053) ZXD family zinc finger C
domestic guinea pig(100718415) ZXD family zinc finger C
cow(789590) ZXD family zinc finger C
sheep(101114563) ZXD family zinc finger C
119 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302985 ANTI-ZXDC (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
flow cytometry, immunohistochemistry, western blot pricing
AV50448 Anti-ZXDC antibody produced in rabbit affinity isolated antibody canine, rabbit, human, mouse, rat, guinea pig, horse
western blot pricing
HPA049593 Anti-ZXDC antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025112 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025112 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025112 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030260 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030260 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030260 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040653 Rosetta Predictions human pricing
NM_025112 Rosetta Predictions human pricing
XM_575607 Rosetta Predictions rat pricing
NM_030260 Rosetta Predictions mouse pricing
NM_173002 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040653 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133550 predicted 1669
2 SASI_Hs02_00309029 predicted 949
3 SASI_Hs01_00133551 predicted 1604
4 SASI_Hs01_00133552 predicted 1062
5 SASI_Hs01_00133553 predicted 788
6 SASI_Hs01_00133554 predicted 1507
7 SASI_Hs01_00133555 predicted 782
8 SASI_Hs01_00133556 predicted 1646
9 SASI_Hs01_00133557 predicted 945
10 SASI_Hs01_00133558 predicted 1907
11 SASI_Hs01_00133549 predicted 1356
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025112 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087859 predicted 1668
2 SASI_Hs02_00357810 predicted 949
3 SASI_Hs01_00087860 predicted 1606
4 SASI_Hs01_00087861 predicted 1066
5 SASI_Hs01_00087862 predicted 791
6 SASI_Hs01_00087863 predicted 1505
7 SASI_Hs01_00087864 predicted 789
8 SASI_Hs01_00087865 predicted 1640
9 SASI_Hs01_00087866 predicted 949
10 SASI_Hs01_00087867 predicted 1905
11 SASI_Hs01_00087858 predicted 1353
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575607 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00403913 predicted 2799
2 SASI_Rn02_00403914 predicted 2681
3 SASI_Rn02_00403915 predicted 2685
4 SASI_Rn02_00403916 predicted 2770
5 SASI_Rn02_00403917 predicted 2663
6 SASI_Rn02_00403918 predicted 2645
7 SASI_Rn02_00403919 predicted 2605
8 SASI_Rn02_00403920 predicted 2500
9 SASI_Rn02_00403921 predicted 537
10 SASI_Rn02_00403922 predicted 2674
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030260 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00128846 predicted 1155
2 SASI_Mm01_00128847 predicted 1783
3 SASI_Mm01_00128848 predicted 1882
4 SASI_Mm01_00128849 predicted 1816
5 SASI_Mm01_00128850 predicted 1273
6 SASI_Mm01_00128852 predicted 1461
7 SASI_Mm01_00128853 predicted 1177
8 SASI_Mm01_00128854 predicted 1401
9 SASI_Mm01_00128855 predicted 1723
10 SASI_Mm02_00336733 predicted 1652
11 SASI_Mm01_00128851 predicted 1209
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173002 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00077618 predicted 1151
2 SASI_Mm01_00077619 predicted 1774
3 SASI_Mm01_00077620 predicted 1875
4 SASI_Mm01_00077621 predicted 1815
5 SASI_Mm01_00077622 predicted 1276
6 SASI_Mm01_00077624 predicted 1466
7 SASI_Mm01_00077625 predicted 1176
8 SASI_Mm01_00077626 predicted 1401
9 SASI_Mm01_00077627 predicted 1720
10 SASI_Mm02_00345048 predicted 1646
11 SASI_Mm01_00077623 predicted 1116
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025112
VALIDATED
ZXDC MISSION shRNA Bacterial Glycerol Stock
ZXD family zinc finger C
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025112.3-1338s1c1
Sequence:CCGGCCTCACAGTCTACTCAGAGAACTCGAGTTCTCTGAGTAGACTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025112.3-782s1c1
Sequence:CCGGCCTGCTAATAATAGCTCCCTACTCGAGTAGGGAGCTATTATTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025112.3-1284s1c1
Sequence:CCGGCCATTCAACTAGCCAAGGAAACTCGAGTTTCCTTGGCTAGTTGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_025112.3-420s1c1
Sequence:CCGGGCAGTCTGTACATTCACTCTACTCGAGTAGAGTGAATGTACAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245361    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025112.4-3238s21c1
Sequence:CCGGGCCCTCTTCCCAGACTAAATTCTCGAGAATTTAGTCTGGGAAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025112.4-1200s21c1
Sequence:CCGGTGACGATGACCGGAGGTTTACCTCGAGGTAAACCTCCGGTCATCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025112.4-1056s21c1
Sequence:CCGGGTGCAGCAAGCAGTATGATAACTCGAGTTATCATACTGCTTGCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025112.4-960s21c1
Sequence:CCGGCGGCTGTGAGAAGACATTTATCTCGAGATAAATGTCTTCTCACAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025112.4-794s21c1
Sequence:CCGGAGAAGTTCACTACGGTCTATACTCGAGTATAGACCGTAGTGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025112
VALIDATED
ZXDC MISSION shRNA shRNA Plasmid DNA
ZXD family zinc finger C
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025112.3-1338s1c1
Sequence:CCGGCCTCACAGTCTACTCAGAGAACTCGAGTTCTCTGAGTAGACTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025112.3-782s1c1
Sequence:CCGGCCTGCTAATAATAGCTCCCTACTCGAGTAGGGAGCTATTATTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025112.3-1284s1c1
Sequence:CCGGCCATTCAACTAGCCAAGGAAACTCGAGTTTCCTTGGCTAGTTGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_025112.3-420s1c1
Sequence:CCGGGCAGTCTGTACATTCACTCTACTCGAGTAGAGTGAATGTACAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245361    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025112.4-3238s21c1
Sequence:CCGGGCCCTCTTCCCAGACTAAATTCTCGAGAATTTAGTCTGGGAAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025112.4-1200s21c1
Sequence:CCGGTGACGATGACCGGAGGTTTACCTCGAGGTAAACCTCCGGTCATCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025112.4-1056s21c1
Sequence:CCGGGTGCAGCAAGCAGTATGATAACTCGAGTTATCATACTGCTTGCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025112.4-960s21c1
Sequence:CCGGCGGCTGTGAGAAGACATTTATCTCGAGATAAATGTCTTCTCACAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025112.4-794s21c1
Sequence:CCGGAGAAGTTCACTACGGTCTATACTCGAGTATAGACCGTAGTGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025112
VALIDATED
ZXDC MISSION shRNA Lentiviral Transduction Particles
ZXD family zinc finger C
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025112.3-1338s1c1
Sequence:CCGGCCTCACAGTCTACTCAGAGAACTCGAGTTCTCTGAGTAGACTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025112.3-782s1c1
Sequence:CCGGCCTGCTAATAATAGCTCCCTACTCGAGTAGGGAGCTATTATTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025112.3-1284s1c1
Sequence:CCGGCCATTCAACTAGCCAAGGAAACTCGAGTTTCCTTGGCTAGTTGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_025112.3-420s1c1
Sequence:CCGGGCAGTCTGTACATTCACTCTACTCGAGTAGAGTGAATGTACAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245361    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025112.4-3238s21c1
Sequence:CCGGGCCCTCTTCCCAGACTAAATTCTCGAGAATTTAGTCTGGGAAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025112.4-1200s21c1
Sequence:CCGGTGACGATGACCGGAGGTTTACCTCGAGGTAAACCTCCGGTCATCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025112.4-1056s21c1
Sequence:CCGGGTGCAGCAAGCAGTATGATAACTCGAGTTATCATACTGCTTGCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025112.4-960s21c1
Sequence:CCGGCGGCTGTGAGAAGACATTTATCTCGAGATAAATGTCTTCTCACAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025112.4-794s21c1
Sequence:CCGGAGAAGTTCACTACGGTCTATACTCGAGTATAGACCGTAGTGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030260
ZXDC MISSION shRNA Bacterial Glycerol Stock
ZXD family zinc finger C
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104855    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030260.1-2476s1c1
Sequence:CCGGGCTTAACTTATCTGAGCCCTACTCGAGTAGGGCTCAGATAAGTTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030260.1-1812s1c1
Sequence:CCGGCCTACTAACAATAACTCCTTACTCGAGTAAGGAGTTATTGTTAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030260.1-1149s1c1
Sequence:CCGGCCTGGGTGCAATAAACAATATCTCGAGATATTGTTTATTGCACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030260.1-2307s1c1
Sequence:CCGGCCACTAGCTCACTTCCCTAATCTCGAGATTAGGGAAGTGAGCTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030260.1-1878s1c1
Sequence:CCGGCCAAGTTTGGACAGTCCTCTTCTCGAGAAGAGGACTGTCCAAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331867    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030260.3-2494s21c1
Sequence:CCGGGCTTAACTTATCTGAGCCCTACTCGAGTAGGGCTCAGATAAGTTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030260.3-1828s21c1
Sequence:CCGGCCTACTAACAATAACTCCTTACTCGAGTAAGGAGTTATTGTTAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302984    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030260.3-2325s21c1
Sequence:CCGGCCACTAGCTCACTTCCCTAATCTCGAGATTAGGGAAGTGAGCTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030260.3-1165s21c1
Sequence:CCGGCCTGGGTGCAATAAACAATATCTCGAGATATTGTTTATTGCACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030260.3-1894s21c1
Sequence:CCGGCCAAGTTTGGACAGTCCTCTTCTCGAGAAGAGGACTGTCCAAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030260
ZXDC MISSION shRNA shRNA Plasmid DNA
ZXD family zinc finger C
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104855    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030260.1-2476s1c1
Sequence:CCGGGCTTAACTTATCTGAGCCCTACTCGAGTAGGGCTCAGATAAGTTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030260.1-1812s1c1
Sequence:CCGGCCTACTAACAATAACTCCTTACTCGAGTAAGGAGTTATTGTTAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030260.1-1149s1c1
Sequence:CCGGCCTGGGTGCAATAAACAATATCTCGAGATATTGTTTATTGCACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030260.1-2307s1c1
Sequence:CCGGCCACTAGCTCACTTCCCTAATCTCGAGATTAGGGAAGTGAGCTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030260.1-1878s1c1
Sequence:CCGGCCAAGTTTGGACAGTCCTCTTCTCGAGAAGAGGACTGTCCAAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331867    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030260.3-2494s21c1
Sequence:CCGGGCTTAACTTATCTGAGCCCTACTCGAGTAGGGCTCAGATAAGTTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030260.3-1828s21c1
Sequence:CCGGCCTACTAACAATAACTCCTTACTCGAGTAAGGAGTTATTGTTAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302984    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030260.3-2325s21c1
Sequence:CCGGCCACTAGCTCACTTCCCTAATCTCGAGATTAGGGAAGTGAGCTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030260.3-1165s21c1
Sequence:CCGGCCTGGGTGCAATAAACAATATCTCGAGATATTGTTTATTGCACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030260.3-1894s21c1
Sequence:CCGGCCAAGTTTGGACAGTCCTCTTCTCGAGAAGAGGACTGTCCAAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030260
ZXDC MISSION shRNA Lentiviral Transduction Particles
ZXD family zinc finger C
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104855    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030260.1-2476s1c1
Sequence:CCGGGCTTAACTTATCTGAGCCCTACTCGAGTAGGGCTCAGATAAGTTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030260.1-1812s1c1
Sequence:CCGGCCTACTAACAATAACTCCTTACTCGAGTAAGGAGTTATTGTTAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030260.1-1149s1c1
Sequence:CCGGCCTGGGTGCAATAAACAATATCTCGAGATATTGTTTATTGCACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030260.1-2307s1c1
Sequence:CCGGCCACTAGCTCACTTCCCTAATCTCGAGATTAGGGAAGTGAGCTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030260.1-1878s1c1
Sequence:CCGGCCAAGTTTGGACAGTCCTCTTCTCGAGAAGAGGACTGTCCAAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331867    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030260.3-2494s21c1
Sequence:CCGGGCTTAACTTATCTGAGCCCTACTCGAGTAGGGCTCAGATAAGTTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030260.3-1828s21c1
Sequence:CCGGCCTACTAACAATAACTCCTTACTCGAGTAAGGAGTTATTGTTAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302984    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030260.3-2325s21c1
Sequence:CCGGCCACTAGCTCACTTCCCTAATCTCGAGATTAGGGAAGTGAGCTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030260.3-1165s21c1
Sequence:CCGGCCTGGGTGCAATAAACAATATCTCGAGATATTGTTTATTGCACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030260.3-1894s21c1
Sequence:CCGGCCAAGTTTGGACAGTCCTCTTCTCGAGAAGAGGACTGTCCAAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks