EMAIL THIS PAGE TO A FRIEND

ZYG11A

zyg-11 family member A, cell cycle regulator

Synonyms: ZYG11
UniProtKB ID: Q6WRX3, A6NCK5
Gene ID:
Mouse(230590) zyg-11 family member A, cell cycle regulator
Rat(313482) zyg-11 family member A, cell cycle regulator
domestic cat(101092780) zyg-11 homolog A (C. elegans)
Horse(100061512) zyg-11 homolog A (C. elegans)
dog(610740) zyg-11 homolog A (C. elegans)
cow(521973) zyg-11 homolog A (C. elegans)
sheep(101116518) zyg-11 homolog A (C. elegans)
domestic guinea pig(100730692) zyg-11 family member A, cell cycle regulator
naked mole-rat(101707946) zyg-11 family member A, cell cycle regulator
Domestic Rabbit(100347913) zyg-11 homolog A (C. elegans)
87 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004339 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004339 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004339 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU089331 MISSION® esiRNA esiRNA targeting mouse Zyg11a (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001133615 Rosetta Predictions human pricing
XM_001718774 Rosetta Predictions human pricing
XM_941659 Rosetta Predictions human pricing
XM_001066935 Rosetta Predictions rat pricing
XM_233348 Rosetta Predictions rat pricing
XM_001478923 Rosetta Predictions mouse pricing
XM_131619 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001133615 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00391077 predicted 2148
2 SASI_Hs02_00391078 predicted 2105
3 SASI_Hs02_00391079 predicted 2099
4 SASI_Hs02_00391080 predicted 1488
5 SASI_Hs02_00391081 predicted 1487
6 SASI_Hs02_00391082 predicted 1400
7 SASI_Hs02_00391083 predicted 1416
8 SASI_Hs02_00391084 predicted 1493
9 SASI_Hs02_00391085 predicted 1415
10 SASI_Hs02_00391086 predicted 2007
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001718774 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00426231 predicted 1164
2 SASI_Hs02_00426232 predicted 2113
3 SASI_Hs02_00426233 predicted 830
4 SASI_Hs02_00426234 predicted 664
5 SASI_Hs02_00426235 predicted 1710
6 SASI_Hs02_00426236 predicted 441
7 SASI_Hs02_00426237 predicted 370
8 SASI_Hs02_00426238 predicted 752
9 SASI_Hs02_00426239 predicted 876
10 SASI_Hs02_00426240 predicted 765
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_941659 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00485031 predicted 1168
2 SASI_Hs02_00485032 predicted 2105
3 SASI_Hs02_00485033 predicted 827
4 SASI_Hs02_00485034 predicted 663
5 SASI_Hs02_00485035 predicted 1709
6 SASI_Hs02_00485036 predicted 449
7 SASI_Hs02_00485037 predicted 367
8 SASI_Hs02_00485038 predicted 746
9 SASI_Hs02_00485039 predicted 878
10 SASI_Hs02_00485040 predicted 773
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066935 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00319262 predicted 1363
2 SASI_Rn02_00319263 predicted 635
3 SASI_Rn02_00319264 predicted 1726
4 SASI_Rn02_00319265 predicted 736
5 SASI_Rn02_00319266 predicted 1539
6 SASI_Rn02_00319267 predicted 1133
7 SASI_Rn02_00319268 predicted 210
8 SASI_Rn02_00319269 predicted 1830
9 SASI_Rn02_00319270 predicted 419
10 SASI_Rn02_00319271 predicted 519
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_233348 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00387682 predicted 1363
2 SASI_Rn02_00387683 predicted 1722
3 SASI_Rn02_00387684 predicted 728
4 SASI_Rn02_00387685 predicted 1539
5 SASI_Rn02_00387686 predicted 1139
6 SASI_Rn02_00387687 predicted 1839
7 SASI_Rn02_00387688 predicted 1677
8 SASI_Rn02_00387689 predicted 937
9 SASI_Rn02_00387690 predicted 1543
10 SASI_Rn02_00387691 predicted 1791
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001478923 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00406346 predicted 1458
2 SASI_Mm02_00406347 predicted 433
3 SASI_Mm02_00406348 predicted 1602
4 SASI_Mm02_00406349 predicted 1451
5 SASI_Mm02_00406350 predicted 1283
6 SASI_Mm02_00406351 predicted 771
7 SASI_Mm02_00406352 predicted 1670
8 SASI_Mm02_00406353 predicted 1086
9 SASI_Mm02_00406354 predicted 942
10 SASI_Mm02_00406355 predicted 855
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_131619 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00424423 predicted 2339
2 SASI_Mm02_00424424 predicted 2432
3 SASI_Mm02_00424425 predicted 2399
4 SASI_Mm01_00283986 predicted 285
5 SASI_Mm02_00424426 predicted 2363
6 SASI_Mm01_00283987 predicted 293
7 SASI_Mm01_00283989 predicted 370
8 SASI_Mm02_00424427 predicted 457
9 SASI_Mm01_00283990 predicted 511
10 SASI_Mm02_00424428 predicted 2353
11 SASI_Mm01_00283988 predicted 493
12 SASI_Mm01_00283991 predicted 290
13 SASI_Mm01_00283992 predicted 460
14 SASI_Mm01_00283993 predicted 216
15 SASI_Mm01_00283994 predicted 489
16 SASI_Mm01_00283995 predicted 465
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004339
ZYG11A MISSION shRNA Bacterial Glycerol Stock
zyg-11 family member A, cell cycle regulator
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004339.1-735s1c1
Sequence:CCGGGAGGTAACCATGCCTGCTATTCTCGAGAATAGCAGGCATGGTTACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004339.1-1432s1c1
Sequence:CCGGGTTTACTCTGTAGCAGGGAAACTCGAGTTTCCCTGCTACAGAGTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004339.1-1415s1c1
Sequence:CCGGGCTGAAGCATATCAACAGTTTCTCGAGAAACTGTTGATATGCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004339.1-1071s1c1
Sequence:CCGGGCAGTGAGTGTCACCTCTATTCTCGAGAATAGAGGTGACACTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137701    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004339.1-1989s1c1
Sequence:CCGGGCTGTCTCATTGGCCTTTGATCTCGAGATCAAAGGCCAATGAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137908    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004339.1-2852s1c1
Sequence:CCGGGCTGTGTATGTGAGTGAGCTTCTCGAGAAGCTCACTCACATACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004339
ZYG11A MISSION shRNA shRNA Plasmid DNA
zyg-11 family member A, cell cycle regulator
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004339.1-735s1c1
Sequence:CCGGGAGGTAACCATGCCTGCTATTCTCGAGAATAGCAGGCATGGTTACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004339.1-1432s1c1
Sequence:CCGGGTTTACTCTGTAGCAGGGAAACTCGAGTTTCCCTGCTACAGAGTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004339.1-1415s1c1
Sequence:CCGGGCTGAAGCATATCAACAGTTTCTCGAGAAACTGTTGATATGCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004339.1-1071s1c1
Sequence:CCGGGCAGTGAGTGTCACCTCTATTCTCGAGAATAGAGGTGACACTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137701    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004339.1-1989s1c1
Sequence:CCGGGCTGTCTCATTGGCCTTTGATCTCGAGATCAAAGGCCAATGAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137908    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004339.1-2852s1c1
Sequence:CCGGGCTGTGTATGTGAGTGAGCTTCTCGAGAAGCTCACTCACATACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004339
ZYG11A MISSION shRNA Lentiviral Transduction Particles
zyg-11 family member A, cell cycle regulator
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004339.1-735s1c1
Sequence:CCGGGAGGTAACCATGCCTGCTATTCTCGAGAATAGCAGGCATGGTTACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004339.1-1432s1c1
Sequence:CCGGGTTTACTCTGTAGCAGGGAAACTCGAGTTTCCCTGCTACAGAGTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004339.1-1415s1c1
Sequence:CCGGGCTGAAGCATATCAACAGTTTCTCGAGAAACTGTTGATATGCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004339.1-1071s1c1
Sequence:CCGGGCAGTGAGTGTCACCTCTATTCTCGAGAATAGAGGTGACACTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137701    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004339.1-1989s1c1
Sequence:CCGGGCTGTCTCATTGGCCTTTGATCTCGAGATCAAAGGCCAATGAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137908    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004339.1-2852s1c1
Sequence:CCGGGCTGTGTATGTGAGTGAGCTTCTCGAGAAGCTCACTCACATACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks