EMAIL THIS PAGE TO A FRIEND

ZYG11B

zyg-11 family member B, cell cycle regulator

Synonyms: ZYG11
UniProtKB ID: Q9C0D3, Q8N2X3, Q9H8L8
Gene ID:
Mouse(414872) zyg-ll family member B, cell cycle regulator
Rat(362559) zyg-11 family member B, cell cycle regulator
chicken(424645) zyg-11 homolog B (C. elegans)
dog(482495) zyg-11 homolog B (C. elegans)
Horse(100061587) zyg-11 homolog B (C. elegans)
domestic cat(101092531) zyg-11 homolog B (C. elegans)
naked mole-rat(101708197) zyg-11 family member B, cell cycle regulator
domestic guinea pig(100730415) zyg-11 family member B, cell cycle regulator
cow(540744) zyg-11 homolog B (C. elegans)
sheep(101116266) zyg-11 homolog B (C. elegans)
152 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024646 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024646 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024646 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033634 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033634 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033634 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU022091 MISSION® esiRNA esiRNA human ZYG11B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024646 Rosetta Predictions human pricing
XM_001060075 Rosetta Predictions rat pricing
XM_342878 Rosetta Predictions rat pricing
NM_001033634 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024646 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044367 predicted 2380
2 SASI_Hs01_00044368 predicted 2079
3 SASI_Hs01_00044369 predicted 1392
4 SASI_Hs01_00044370 predicted 697
5 SASI_Hs02_00357042 predicted 2163
6 SASI_Hs01_00044371 predicted 809
7 SASI_Hs01_00044372 predicted 2365
8 SASI_Hs01_00044375 predicted 1714
9 SASI_Hs01_00044376 predicted 1978
10 SASI_Hs02_00357043 predicted 1139
11 SASI_Hs01_00044373 predicted 2394
12 SASI_Hs01_00044374 predicted 2228
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060075 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00295282 predicted 1715
2 SASI_Rn02_00295283 predicted 2207
3 SASI_Rn02_00295284 predicted 581
4 SASI_Rn02_00295285 predicted 1426
5 SASI_Rn02_00295286 predicted 927
6 SASI_Rn02_00295287 predicted 2222
7 SASI_Rn02_00295288 predicted 848
8 SASI_Rn02_00295289 predicted 351
9 SASI_Rn02_00295290 predicted 699
10 SASI_Rn02_00295291 predicted 559
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342878 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394951 predicted 2337
2 SASI_Rn02_00394952 predicted 1716
3 SASI_Rn02_00394953 predicted 2208
4 SASI_Rn02_00394954 predicted 2240
5 SASI_Rn02_00394955 predicted 1811
6 SASI_Rn02_00394956 predicted 1970
7 SASI_Rn02_00394957 predicted 1430
8 SASI_Rn02_00394958 predicted 928
9 SASI_Rn02_00394959 predicted 2227
10 SASI_Rn02_00394960 predicted 850
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033634 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00099364 predicted 550
2 SASI_Mm01_00099365 predicted 1270
3 SASI_Mm01_00099366 predicted 1332
4 SASI_Mm01_00099370 predicted 1867
5 SASI_Mm01_00099367 predicted 1698
6 SASI_Mm01_00099368 predicted 738
7 SASI_Mm01_00099369 predicted 839
8 SASI_Mm01_00099372 predicted 1283
9 SASI_Mm02_00288952 predicted 224
10 SASI_Mm02_00288953 predicted 205
11 SASI_Mm01_00099363 predicted 2334
12 SASI_Mm01_00099371 predicted 2225
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024646
VALIDATED
ZYG11B MISSION shRNA Bacterial Glycerol Stock
zyg-11 family member B, cell cycle regulator
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168076    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024646.1-638s1c1
Sequence:CCGGCGAGCTTTAAGCATCACGAATCTCGAGATTCGTGATGCTTAAAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024646.2-427s21c1
Sequence:CCGGGGCAACCAGATGCGCTTAAAGCTCGAGCTTTAAGCGCATCTGGTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024646.2-1592s21c1
Sequence:CCGGGGATGGCAGTTGCTATCATTTCTCGAGAAATGATAGCAACTGCCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024646.2-755s21c1
Sequence:CCGGGATTAGAGAGCTTGGATATTTCTCGAGAAATATCCAAGCTCTCTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246308    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024646.2-3101s21c1
Sequence:CCGGGAAGCTTGTCCTCCATATTTACTCGAGTAAATATGGAGGACAAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024646.2-2419s21c1
Sequence:CCGGAGACTAAATTGATAGCCATAACTCGAGTTATGGCTATCAATTTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024646
VALIDATED
ZYG11B MISSION shRNA shRNA Plasmid DNA
zyg-11 family member B, cell cycle regulator
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168076    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024646.1-638s1c1
Sequence:CCGGCGAGCTTTAAGCATCACGAATCTCGAGATTCGTGATGCTTAAAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024646.2-427s21c1
Sequence:CCGGGGCAACCAGATGCGCTTAAAGCTCGAGCTTTAAGCGCATCTGGTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024646.2-1592s21c1
Sequence:CCGGGGATGGCAGTTGCTATCATTTCTCGAGAAATGATAGCAACTGCCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024646.2-755s21c1
Sequence:CCGGGATTAGAGAGCTTGGATATTTCTCGAGAAATATCCAAGCTCTCTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246308    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024646.2-3101s21c1
Sequence:CCGGGAAGCTTGTCCTCCATATTTACTCGAGTAAATATGGAGGACAAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024646.2-2419s21c1
Sequence:CCGGAGACTAAATTGATAGCCATAACTCGAGTTATGGCTATCAATTTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024646
VALIDATED
ZYG11B MISSION shRNA Lentiviral Transduction Particles
zyg-11 family member B, cell cycle regulator
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168076    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024646.1-638s1c1
Sequence:CCGGCGAGCTTTAAGCATCACGAATCTCGAGATTCGTGATGCTTAAAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024646.2-427s21c1
Sequence:CCGGGGCAACCAGATGCGCTTAAAGCTCGAGCTTTAAGCGCATCTGGTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024646.2-1592s21c1
Sequence:CCGGGGATGGCAGTTGCTATCATTTCTCGAGAAATGATAGCAACTGCCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024646.2-755s21c1
Sequence:CCGGGATTAGAGAGCTTGGATATTTCTCGAGAAATATCCAAGCTCTCTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246308    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024646.2-3101s21c1
Sequence:CCGGGAAGCTTGTCCTCCATATTTACTCGAGTAAATATGGAGGACAAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024646.2-2419s21c1
Sequence:CCGGAGACTAAATTGATAGCCATAACTCGAGTTATGGCTATCAATTTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033634
ZYG11B MISSION shRNA Bacterial Glycerol Stock
zyg-11 family member B, cell cycle regulator
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267628    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033634.3-3189s21c1
Sequence:CCGGGTGTATCTGTCAGGCATAAATCTCGAGATTTATGCCTGACAGATACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033634.3-402s21c1
Sequence:CCGGGGTAACCAGATGCGCCTAAAGCTCGAGCTTTAGGCGCATCTGGTTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033634.3-337s21c1
Sequence:CCGGACCGGCTTCTTCAGACTATAGCTCGAGCTATAGTCTGAAGAAGCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033634.3-663s21c1
Sequence:CCGGCGAGCTCTGAGCATCACTAATCTCGAGATTAGTGATGCTCAGAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033634.3-1567s21c1
Sequence:CCGGGCATGGCCGTGGCTATCATTTCTCGAGAAATGATAGCCACGGCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033634
ZYG11B MISSION shRNA shRNA Plasmid DNA
zyg-11 family member B, cell cycle regulator
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267628    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033634.3-3189s21c1
Sequence:CCGGGTGTATCTGTCAGGCATAAATCTCGAGATTTATGCCTGACAGATACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033634.3-402s21c1
Sequence:CCGGGGTAACCAGATGCGCCTAAAGCTCGAGCTTTAGGCGCATCTGGTTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033634.3-337s21c1
Sequence:CCGGACCGGCTTCTTCAGACTATAGCTCGAGCTATAGTCTGAAGAAGCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033634.3-663s21c1
Sequence:CCGGCGAGCTCTGAGCATCACTAATCTCGAGATTAGTGATGCTCAGAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033634.3-1567s21c1
Sequence:CCGGGCATGGCCGTGGCTATCATTTCTCGAGAAATGATAGCCACGGCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033634
ZYG11B MISSION shRNA Lentiviral Transduction Particles
zyg-11 family member B, cell cycle regulator
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267628    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033634.3-3189s21c1
Sequence:CCGGGTGTATCTGTCAGGCATAAATCTCGAGATTTATGCCTGACAGATACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033634.3-402s21c1
Sequence:CCGGGGTAACCAGATGCGCCTAAAGCTCGAGCTTTAGGCGCATCTGGTTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033634.3-337s21c1
Sequence:CCGGACCGGCTTCTTCAGACTATAGCTCGAGCTATAGTCTGAAGAAGCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033634.3-663s21c1
Sequence:CCGGCGAGCTCTGAGCATCACTAATCTCGAGATTAGTGATGCTCAGAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033634.3-1567s21c1
Sequence:CCGGGCATGGCCGTGGCTATCATTTCTCGAGAAATGATAGCCACGGCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks