EMAIL THIS PAGE TO A FRIEND

ZYX

zyxin

Synonyms: ESP-2 HED-2
UniProtKB ID: Q15942, A4D2G6, Q6I9S4
Gene ID:
Human(7791) Summary: Focal adhesions are actin-rich structures that enable cells to adhere to the extracellular matrix and at which protein complexes involved in signal transduction assemble. Zyxin is a zinc-binding phosphoprotein that concentrates at focal adhesions and along the actin cytoskeleton. Zyxin has an N-terminal proline-rich domain and three LIM domains in its C-terminal half. The proline-rich domain may interact with SH3 domains of proteins involved in signal transduction pathways while the LIM domains are likely involved in protein-protein binding. Zyxin may function as a messenger in the signal transduction pathway that mediates adhesion-stimulated changes in gene expression and may modulate the cytoskeletal organization of actin bundles. Alternative splicing results in multiple transcript variants that encode the same isoform. [provided by RefSeq, Jul 2008]
Mouse(22793) zyxin
Rat(114636) zyxin
dog(482736) zyxin
cow(768226) zyxin
86 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4504739 Anti-phospho-Zyxin (pSer142) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB2501639 Anti-ZYX antibody produced in goat affinity isolated antibody, buffered aqueous solution canine, human
ELISA, western blot pricing
SAB1406630 Anti-ZYX antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
HPA004835 Anti-ZYX antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
AV34387 Anti-ZYX antibody produced in rabbit IgG fraction of antiserum human, rat, rabbit, horse, bovine, mouse, guinea pig
western blot pricing
SAB2104150 Anti-ZYX antibody produced in rabbit affinity isolated antibody guinea pig, horse, rabbit, human, bovine
western blot pricing
HPA073497 Anti-ZYX antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
Z4751 Anti-Zyxin antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse, rat
immunofluorescence, western blot pricing
Z0377 Anti-Zyxin antibody, Mouse monoclonal clone ZOL301, purified from hybridoma cell culture human, rat, mouse
ELISA, immunocytochemistry, microarray, western blot pricing
WH0007791M1 Monoclonal Anti-ZYX antibody produced in mouse clone 2C10-4A7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404556 Monoclonal Anti-ZYX antibody produced in mouse clone 2D1, purified immunoglobulin, buffered aqueous solution mouse, human
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011777 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011777 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011777 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003461 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003461 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003461 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU025131 MISSION® esiRNA esiRNA targeting mouse Zyx (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010972 Rosetta Predictions human pricing
NM_003461 Rosetta Predictions human pricing
XM_001072096 Rosetta Predictions rat pricing
XM_216124 Rosetta Predictions rat pricing
NM_011777 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010972 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231282 predicted 1441
2 SASI_Hs01_00231283 predicted 1820
3 SASI_Hs01_00231284 predicted 595
4 SASI_Hs01_00231285 predicted 1273
5 SASI_Hs01_00231287 predicted 577
6 SASI_Hs01_00231288 predicted 1532
7 SASI_Hs02_00305946 predicted 566
8 SASI_Hs01_00231289 predicted 1362
9 SASI_Hs01_00231290 predicted 1693
10 SASI_Hs02_00305947 predicted 475
11 SASI_Hs01_00231281 predicted 2030
12 SASI_Hs01_00231286 predicted 1283
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003461 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108399 predicted 1449
2 SASI_Hs01_00108400 predicted 1828
3 SASI_Hs01_00108401 predicted 593
4 SASI_Hs01_00108402 predicted 1278
5 SASI_Hs01_00108404 predicted 585
6 SASI_Hs01_00108405 predicted 1535
7 SASI_Hs02_00335708 predicted 572
8 SASI_Hs01_00108406 predicted 1373
9 SASI_Hs01_00108407 predicted 1705
10 SASI_Hs02_00335709 predicted 474
11 SASI_Hs01_00108398 predicted 2026
12 SASI_Hs01_00108403 predicted 1279
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072096 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00337793 predicted 1848
2 SASI_Rn02_00337794 predicted 1871
3 SASI_Rn02_00337795 predicted 1572
4 SASI_Rn02_00337796 predicted 731
5 SASI_Rn02_00337797 predicted 1759
6 SASI_Rn02_00337798 predicted 1507
7 SASI_Rn02_00337799 predicted 1500
8 SASI_Rn02_00337800 predicted 599
9 SASI_Rn02_00337801 predicted 787
10 SASI_Rn02_00337802 predicted 1727
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_216124 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00376450 predicted 1841
2 SASI_Rn02_00376451 predicted 1867
3 SASI_Rn02_00376452 predicted 1575
4 SASI_Rn02_00376453 predicted 732
5 SASI_Rn02_00376454 predicted 1756
6 SASI_Rn02_00376455 predicted 1504
7 SASI_Rn02_00376456 predicted 1498
8 SASI_Rn02_00376457 predicted 595
9 SASI_Rn02_00376458 predicted 785
10 SASI_Rn02_00376459 predicted 1727
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011777 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00190249 predicted 1838
2 SASI_Mm01_00190250 predicted 591
3 SASI_Mm01_00190251 predicted 1414
4 SASI_Mm01_00190252 predicted 2178
5 SASI_Mm02_00321423 predicted 1416
6 SASI_Mm01_00190253 predicted 2043
7 SASI_Mm01_00190254 predicted 790
8 SASI_Mm01_00190255 predicted 1052
9 SASI_Mm01_00190256 predicted 1414
10 SASI_Mm01_00190257 predicted 1592
11 SASI_Mm01_00190258 predicted 1657
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011777
VALIDATED
ZYX MISSION shRNA Bacterial Glycerol Stock
zyxin
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000317466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011777.2-1855s21c1
Sequence:CCGGGCTGGATAAGAACTTTCATATCTCGAGATATGAAAGTTCTTATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313882    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011777.2-2132s21c1
Sequence:CCGGTCAGCATGGCCTACAAGTATTCTCGAGAATACTTGTAGGCCATGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011777.2-731s21c1
Sequence:CCGGTGCAGTATTGACCTGGAGATTCTCGAGAATCTCCAGGTCAATACTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011777.2-1056s21c1
Sequence:CCGGCAACTCCAGCACCTAAGTTTGCTCGAGCAAACTTAGGTGCTGGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011777.2-1005s21c1
Sequence:CCGGAGCCTGTGTCTTCTGCTAATACTCGAGTATTAGCAGAAGACACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075543    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011777.1-1944s1c1
Sequence:CCGGCCAACCCAAGGGTCACATATACTCGAGTATATGTGACCCTTGGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011777.1-1563s1c1
Sequence:CCGGGCTGGATAAGAACTTTCATATCTCGAGATATGAAAGTTCTTATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011777.1-1561s1c1
Sequence:CCGGGCGCTGGATAAGAACTTTCATCTCGAGATGAAAGTTCTTATCCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011777.1-1467s1c1
Sequence:CCGGCCCTGACTATCACAAGCAATACTCGAGTATTGCTTGTGATAGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011777.1-439s1c1
Sequence:CCGGTGCAGTATTGACCTGGAGATTCTCGAGAATCTCCAGGTCAATACTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011777
VALIDATED
ZYX MISSION shRNA shRNA Plasmid DNA
zyxin
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000317466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011777.2-1855s21c1
Sequence:CCGGGCTGGATAAGAACTTTCATATCTCGAGATATGAAAGTTCTTATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313882    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011777.2-2132s21c1
Sequence:CCGGTCAGCATGGCCTACAAGTATTCTCGAGAATACTTGTAGGCCATGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011777.2-731s21c1
Sequence:CCGGTGCAGTATTGACCTGGAGATTCTCGAGAATCTCCAGGTCAATACTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011777.2-1056s21c1
Sequence:CCGGCAACTCCAGCACCTAAGTTTGCTCGAGCAAACTTAGGTGCTGGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011777.2-1005s21c1
Sequence:CCGGAGCCTGTGTCTTCTGCTAATACTCGAGTATTAGCAGAAGACACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075543    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011777.1-1944s1c1
Sequence:CCGGCCAACCCAAGGGTCACATATACTCGAGTATATGTGACCCTTGGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011777.1-1563s1c1
Sequence:CCGGGCTGGATAAGAACTTTCATATCTCGAGATATGAAAGTTCTTATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011777.1-1561s1c1
Sequence:CCGGGCGCTGGATAAGAACTTTCATCTCGAGATGAAAGTTCTTATCCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011777.1-1467s1c1
Sequence:CCGGCCCTGACTATCACAAGCAATACTCGAGTATTGCTTGTGATAGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011777.1-439s1c1
Sequence:CCGGTGCAGTATTGACCTGGAGATTCTCGAGAATCTCCAGGTCAATACTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011777
VALIDATED
ZYX MISSION shRNA Lentiviral Transduction Particles
zyxin
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000317466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011777.2-1855s21c1
Sequence:CCGGGCTGGATAAGAACTTTCATATCTCGAGATATGAAAGTTCTTATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313882    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011777.2-2132s21c1
Sequence:CCGGTCAGCATGGCCTACAAGTATTCTCGAGAATACTTGTAGGCCATGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011777.2-731s21c1
Sequence:CCGGTGCAGTATTGACCTGGAGATTCTCGAGAATCTCCAGGTCAATACTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011777.2-1056s21c1
Sequence:CCGGCAACTCCAGCACCTAAGTTTGCTCGAGCAAACTTAGGTGCTGGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011777.2-1005s21c1
Sequence:CCGGAGCCTGTGTCTTCTGCTAATACTCGAGTATTAGCAGAAGACACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075543    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011777.1-1944s1c1
Sequence:CCGGCCAACCCAAGGGTCACATATACTCGAGTATATGTGACCCTTGGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011777.1-1563s1c1
Sequence:CCGGGCTGGATAAGAACTTTCATATCTCGAGATATGAAAGTTCTTATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011777.1-1561s1c1
Sequence:CCGGGCGCTGGATAAGAACTTTCATCTCGAGATGAAAGTTCTTATCCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011777.1-1467s1c1
Sequence:CCGGCCCTGACTATCACAAGCAATACTCGAGTATTGCTTGTGATAGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011777.1-439s1c1
Sequence:CCGGTGCAGTATTGACCTGGAGATTCTCGAGAATCTCCAGGTCAATACTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003461
VALIDATED
ZYX MISSION shRNA Bacterial Glycerol Stock
zyxin
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000293684    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003461.4-2026s21c1
Sequence:CCGGGACCCAACATGGTCTAGGGATCTCGAGATCCCTAGACCATGTTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_003461.4-575s21c1
Sequence:CCGGGAAGGTGAGCAGTATTGATTTCTCGAGAAATCAATACTGCTCACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003461.4-1745s21c1
Sequence:CCGGCTTCCACATGAAGTGTTACAACTCGAGTTGTAACACTTCATGTGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_003461.4-1021s21c1
Sequence:CCGGCTGGGTCACAACCAAATCAAACTCGAGTTTGATTTGGTTGTGACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_003461.4-701s21c1
Sequence:CCGGCAGTTCCAAGTCCAGTACCAACTCGAGTTGGTACTGGACTTGGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_003461.4-701s1c1
Sequence:CCGGCAGTTCCAAGTCCAGTACCAACTCGAGTTGGTACTGGACTTGGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003461.4-970s1c1
Sequence:CCGGCTAAGTTTACTCCTGTGGCTTCTCGAGAAGCCACAGGAGTAAACTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_003461.4-1745s1c1
Sequence:CCGGCTTCCACATGAAGTGTTACAACTCGAGTTGTAACACTTCATGTGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003461.4-1021s1c1
Sequence:CCGGCTGGGTCACAACCAAATCAAACTCGAGTTTGATTTGGTTGTGACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074203    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003461.4-2132s1c1
Sequence:CCGGCCAGGTTTAGTGCTGCTGCTTCTCGAGAAGCAGCAGCACTAAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003461
VALIDATED
ZYX MISSION shRNA shRNA Plasmid DNA
zyxin
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000293684    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003461.4-2026s21c1
Sequence:CCGGGACCCAACATGGTCTAGGGATCTCGAGATCCCTAGACCATGTTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_003461.4-575s21c1
Sequence:CCGGGAAGGTGAGCAGTATTGATTTCTCGAGAAATCAATACTGCTCACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003461.4-1745s21c1
Sequence:CCGGCTTCCACATGAAGTGTTACAACTCGAGTTGTAACACTTCATGTGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_003461.4-1021s21c1
Sequence:CCGGCTGGGTCACAACCAAATCAAACTCGAGTTTGATTTGGTTGTGACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_003461.4-701s21c1
Sequence:CCGGCAGTTCCAAGTCCAGTACCAACTCGAGTTGGTACTGGACTTGGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_003461.4-701s1c1
Sequence:CCGGCAGTTCCAAGTCCAGTACCAACTCGAGTTGGTACTGGACTTGGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003461.4-970s1c1
Sequence:CCGGCTAAGTTTACTCCTGTGGCTTCTCGAGAAGCCACAGGAGTAAACTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_003461.4-1745s1c1
Sequence:CCGGCTTCCACATGAAGTGTTACAACTCGAGTTGTAACACTTCATGTGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003461.4-1021s1c1
Sequence:CCGGCTGGGTCACAACCAAATCAAACTCGAGTTTGATTTGGTTGTGACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074203    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003461.4-2132s1c1
Sequence:CCGGCCAGGTTTAGTGCTGCTGCTTCTCGAGAAGCAGCAGCACTAAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003461
VALIDATED
ZYX MISSION shRNA Lentiviral Transduction Particles
zyxin
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000293684    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003461.4-2026s21c1
Sequence:CCGGGACCCAACATGGTCTAGGGATCTCGAGATCCCTAGACCATGTTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_003461.4-575s21c1
Sequence:CCGGGAAGGTGAGCAGTATTGATTTCTCGAGAAATCAATACTGCTCACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003461.4-1745s21c1
Sequence:CCGGCTTCCACATGAAGTGTTACAACTCGAGTTGTAACACTTCATGTGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_003461.4-1021s21c1
Sequence:CCGGCTGGGTCACAACCAAATCAAACTCGAGTTTGATTTGGTTGTGACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_003461.4-701s21c1
Sequence:CCGGCAGTTCCAAGTCCAGTACCAACTCGAGTTGGTACTGGACTTGGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_003461.4-701s1c1
Sequence:CCGGCAGTTCCAAGTCCAGTACCAACTCGAGTTGGTACTGGACTTGGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003461.4-970s1c1
Sequence:CCGGCTAAGTTTACTCCTGTGGCTTCTCGAGAAGCCACAGGAGTAAACTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_003461.4-1745s1c1
Sequence:CCGGCTTCCACATGAAGTGTTACAACTCGAGTTGTAACACTTCATGTGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003461.4-1021s1c1
Sequence:CCGGCTGGGTCACAACCAAATCAAACTCGAGTTTGATTTGGTTGTGACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074203    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003461.4-2132s1c1
Sequence:CCGGCCAGGTTTAGTGCTGCTGCTTCTCGAGAAGCAGCAGCACTAAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks