EMAIL THIS PAGE TO A FRIEND

ZZEF1

zinc finger, ZZ-type with EF-hand domain 1

Synonyms: ZZZ4
UniProtKB ID: O43149, A7MBM5, Q6NXG0, Q6ZRA1, Q6ZSF4, Q9NVB9
Gene ID:
Mouse(195018) zinc finger, ZZ-type with EF hand domain 1
Rat(287476) zinc finger, ZZ-type with EF hand domain 1
Zebrafish(566682) zinc finger, ZZ-type with EF hand domain 1
domestic cat(101086265) zinc finger, ZZ-type with EF-hand domain 1
chicken(417496) zinc finger, ZZ-type with EF-hand domain 1
dog(489436) zinc finger, ZZ-type with EF-hand domain 1
naked mole-rat(101697032) zinc finger, ZZ-type with EF-hand domain 1
domestic guinea pig(100727034) zinc finger, ZZ-type with EF-hand domain 1
cow(508144) zinc finger, ZZ-type with EF-hand domain 1
sheep(101111468) zinc finger, ZZ-type with EF-hand domain 1
Domestic Rabbit(100354719) zinc finger, ZZ-type with EF-hand domain 1
99 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015113 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015113 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015113 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001045536 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001045536 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001045536 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015113 Rosetta Predictions human pricing
XM_001080236 Rosetta Predictions rat pricing
XM_237787 Rosetta Predictions rat pricing
NM_001045536 Rosetta Predictions mouse pricing
XM_111053 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015113 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134426 predicted 5114
2 SASI_Hs01_00134428 predicted 5920
3 SASI_Hs01_00134429 predicted 5974
4 SASI_Hs01_00134430 predicted 6748
5 SASI_Hs01_00134431 predicted 7189
6 SASI_Hs01_00134433 predicted 593
7 SASI_Hs02_00347003 predicted 2822
8 SASI_Hs01_00134434 predicted 5625
9 SASI_Hs01_00134435 predicted 1131
10 SASI_Hs02_00347004 predicted 913
11 SASI_Hs01_00134427 predicted 1437
12 SASI_Hs01_00134432 predicted 8228
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080236 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00367196 predicted 8709
2 SASI_Rn02_00367197 predicted 2817
3 SASI_Rn02_00367198 predicted 3865
4 SASI_Rn02_00367199 predicted 5139
5 SASI_Rn02_00367200 predicted 8498
6 SASI_Rn02_00367201 predicted 4495
7 SASI_Rn02_00367202 predicted 8518
8 SASI_Rn02_00367203 predicted 410
9 SASI_Rn02_00367204 predicted 7266
10 SASI_Rn02_00367205 predicted 6209
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_237787 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00391086 predicted 8709
2 SASI_Rn02_00391087 predicted 2821
3 SASI_Rn02_00391088 predicted 3862
4 SASI_Rn02_00391089 predicted 5136
5 SASI_Rn02_00391090 predicted 8498
6 SASI_Rn02_00391091 predicted 4496
7 SASI_Rn02_00391092 predicted 8513
8 SASI_Rn02_00391093 predicted 409
9 SASI_Rn02_00391094 predicted 7269
10 SASI_Rn02_00391095 predicted 6214
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001045536 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00291694 predicted 7305
2 SASI_Mm02_00291695 predicted 6082
3 SASI_Mm02_00291696 predicted 5654
4 SASI_Mm02_00291697 predicted 7885
5 SASI_Mm02_00291698 predicted 7038
6 SASI_Mm02_00291699 predicted 1243
7 SASI_Mm02_00291700 predicted 8171
8 SASI_Mm02_00291701 predicted 8185
9 SASI_Mm02_00291702 predicted 5370
10 SASI_Mm02_00291703 predicted 1135
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_111053 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00235459 predicted 7504
2 SASI_Mm01_00235460 predicted 8609
3 SASI_Mm01_00235461 predicted 7400
4 SASI_Mm01_00235462 predicted 9044
5 SASI_Mm01_00235463 predicted 8700
6 SASI_Mm01_00235464 predicted 8980
7 SASI_Mm01_00235465 predicted 7243
8 SASI_Mm01_00235466 predicted 8569
9 SASI_Mm01_00235467 predicted 7770
10 SASI_Mm01_00235468 predicted 8596
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015113
VALIDATED
ZZEF1 MISSION shRNA Bacterial Glycerol Stock
zinc finger, ZZ-type with EF-hand domain 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015113.2-658s1c1
Sequence:CCGGGCCTTGATATTCACTCGTCAACTCGAGTTGACGAGTGAATATCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015113.2-6903s1c1
Sequence:CCGGCGCTGCGTTTATATGGATAATCTCGAGATTATCCATATAAACGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055663    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_015113.2-9812s1c1
Sequence:CCGGCGTGAGCTTATGTACCGTGAACTCGAGTTCACGGTACATAAGCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015113.2-2889s1c1
Sequence:CCGGGCCAAGATGAACATCAGTGAACTCGAGTTCACTGATGTTCATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015113.2-8243s1c1
Sequence:CCGGCCCGTATAACAACAACACCAACTCGAGTTGGTGTTGTTGTTATACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015113.3-8577s21c1
Sequence:CCGGAGACTGGCCATCAACGATTAACTCGAGTTAATCGTTGATGGCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015113.3-916s21c1
Sequence:CCGGTTCACACTGGATTCGTTTAAACTCGAGTTTAAACGAATCCAGTGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015113.3-2755s21c1
Sequence:CCGGCCGTTCACTGTGCACGTATTTCTCGAGAAATACGTGCACAGTGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289438    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015113.3-9751s21c1
Sequence:CCGGCGTGAGCTTATGTACCGTGAACTCGAGTTCACGGTACATAAGCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015113.3-3026s21c1
Sequence:CCGGGATCTTGCCGTGGACCTTATTCTCGAGAATAAGGTCCACGGCAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015113
VALIDATED
ZZEF1 MISSION shRNA shRNA Plasmid DNA
zinc finger, ZZ-type with EF-hand domain 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015113.2-658s1c1
Sequence:CCGGGCCTTGATATTCACTCGTCAACTCGAGTTGACGAGTGAATATCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015113.2-6903s1c1
Sequence:CCGGCGCTGCGTTTATATGGATAATCTCGAGATTATCCATATAAACGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055663    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_015113.2-9812s1c1
Sequence:CCGGCGTGAGCTTATGTACCGTGAACTCGAGTTCACGGTACATAAGCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015113.2-2889s1c1
Sequence:CCGGGCCAAGATGAACATCAGTGAACTCGAGTTCACTGATGTTCATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015113.2-8243s1c1
Sequence:CCGGCCCGTATAACAACAACACCAACTCGAGTTGGTGTTGTTGTTATACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015113.3-8577s21c1
Sequence:CCGGAGACTGGCCATCAACGATTAACTCGAGTTAATCGTTGATGGCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015113.3-916s21c1
Sequence:CCGGTTCACACTGGATTCGTTTAAACTCGAGTTTAAACGAATCCAGTGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015113.3-2755s21c1
Sequence:CCGGCCGTTCACTGTGCACGTATTTCTCGAGAAATACGTGCACAGTGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289438    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015113.3-9751s21c1
Sequence:CCGGCGTGAGCTTATGTACCGTGAACTCGAGTTCACGGTACATAAGCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015113.3-3026s21c1
Sequence:CCGGGATCTTGCCGTGGACCTTATTCTCGAGAATAAGGTCCACGGCAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015113
VALIDATED
ZZEF1 MISSION shRNA Lentiviral Transduction Particles
zinc finger, ZZ-type with EF-hand domain 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015113.2-658s1c1
Sequence:CCGGGCCTTGATATTCACTCGTCAACTCGAGTTGACGAGTGAATATCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015113.2-6903s1c1
Sequence:CCGGCGCTGCGTTTATATGGATAATCTCGAGATTATCCATATAAACGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055663    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_015113.2-9812s1c1
Sequence:CCGGCGTGAGCTTATGTACCGTGAACTCGAGTTCACGGTACATAAGCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015113.2-2889s1c1
Sequence:CCGGGCCAAGATGAACATCAGTGAACTCGAGTTCACTGATGTTCATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015113.2-8243s1c1
Sequence:CCGGCCCGTATAACAACAACACCAACTCGAGTTGGTGTTGTTGTTATACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015113.3-8577s21c1
Sequence:CCGGAGACTGGCCATCAACGATTAACTCGAGTTAATCGTTGATGGCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015113.3-916s21c1
Sequence:CCGGTTCACACTGGATTCGTTTAAACTCGAGTTTAAACGAATCCAGTGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015113.3-2755s21c1
Sequence:CCGGCCGTTCACTGTGCACGTATTTCTCGAGAAATACGTGCACAGTGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289438    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015113.3-9751s21c1
Sequence:CCGGCGTGAGCTTATGTACCGTGAACTCGAGTTCACGGTACATAAGCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015113.3-3026s21c1
Sequence:CCGGGATCTTGCCGTGGACCTTATTCTCGAGAATAAGGTCCACGGCAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001045536
VALIDATED
ZZEF1 MISSION shRNA Bacterial Glycerol Stock
zinc finger, ZZ-type with EF-hand domain 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045536.2-3411s21c1
Sequence:CCGGATTAGCCCAGGAGCAACTTATCTCGAGATAAGTTGCTCCTGGGCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238554    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001045536.2-8759s21c1
Sequence:CCGGTATGCATGGACTTGATCATTTCTCGAGAAATGATCAAGTCCATGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001045536.2-567s21c1
Sequence:GTACCGGCCAGGTTTCATCGACATATTTCTCGAGAAATATGTCGATGAAACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001045536.2-3034s21c1
Sequence:CCGGAGCTCGCCATGGATCTTATTGCTCGAGCAATAAGATCCATGGCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001045536.2-3524s21c1
Sequence:CCGGCACCAAAGTTGGGACTTATAACTCGAGTTATAAGTCCCAACTTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001045536
VALIDATED
ZZEF1 MISSION shRNA shRNA Plasmid DNA
zinc finger, ZZ-type with EF-hand domain 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045536.2-3411s21c1
Sequence:CCGGATTAGCCCAGGAGCAACTTATCTCGAGATAAGTTGCTCCTGGGCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238554    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001045536.2-8759s21c1
Sequence:CCGGTATGCATGGACTTGATCATTTCTCGAGAAATGATCAAGTCCATGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001045536.2-567s21c1
Sequence:GTACCGGCCAGGTTTCATCGACATATTTCTCGAGAAATATGTCGATGAAACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001045536.2-3034s21c1
Sequence:CCGGAGCTCGCCATGGATCTTATTGCTCGAGCAATAAGATCCATGGCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001045536.2-3524s21c1
Sequence:CCGGCACCAAAGTTGGGACTTATAACTCGAGTTATAAGTCCCAACTTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001045536
VALIDATED
ZZEF1 MISSION shRNA Lentiviral Transduction Particles
zinc finger, ZZ-type with EF-hand domain 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045536.2-3411s21c1
Sequence:CCGGATTAGCCCAGGAGCAACTTATCTCGAGATAAGTTGCTCCTGGGCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238554    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001045536.2-8759s21c1
Sequence:CCGGTATGCATGGACTTGATCATTTCTCGAGAAATGATCAAGTCCATGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001045536.2-567s21c1
Sequence:GTACCGGCCAGGTTTCATCGACATATTTCTCGAGAAATATGTCGATGAAACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001045536.2-3034s21c1
Sequence:CCGGAGCTCGCCATGGATCTTATTGCTCGAGCAATAAGATCCATGGCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001045536.2-3524s21c1
Sequence:CCGGCACCAAAGTTGGGACTTATAACTCGAGTTATAAGTCCCAACTTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks