EMAIL THIS PAGE TO A FRIEND

ZZZ3

zinc finger, ZZ-type containing 3

Synonyms: ATAC1
Gene ID:
Mouse(108946) zinc finger, ZZ domain containing 3
Rat(310958) zinc finger, ZZ-type containing 3
domestic guinea pig(100714442) zinc finger, ZZ-type containing 3
naked mole-rat(101705476) zinc finger, ZZ-type containing 3
Zebrafish(567022) zinc finger, ZZ-type containing 3
Horse(100053222) zinc finger, ZZ-type containing 3
chicken(424554) zinc finger, ZZ-type containing 3
dog(490203) zinc finger, ZZ-type containing 3
domestic cat(101092283) zinc finger, ZZ-type containing 3
sheep(101122232) zinc finger, ZZ-type containing 3
cow(538498) zinc finger, ZZ-type containing 3
173 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015534 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015534 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015534 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198416 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198416 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198416 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015534 Rosetta Predictions human pricing
NM_001134549 Rosetta Predictions rat pricing
NM_001080755 Rosetta Predictions mouse pricing
NM_198416 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015534 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197219 predicted 862
2 SASI_Hs01_00197221 predicted 2778
3 SASI_Hs01_00197222 predicted 604
4 SASI_Hs01_00197224 predicted 1028
5 SASI_Hs01_00197225 predicted 883
6 SASI_Hs01_00197226 predicted 1259
7 SASI_Hs01_00197227 predicted 2413
8 SASI_Hs02_00348053 predicted 1488
9 SASI_Hs02_00348054 predicted 1984
10 SASI_Hs02_00348055 predicted 1426
11 SASI_Hs01_00197218 predicted 1164
12 SASI_Hs01_00197220 predicted 1956
13 SASI_Hs01_00197223 predicted 3258
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134549 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00256979 predicted 1086
2 SASI_Rn02_00256980 predicted 1216
3 SASI_Rn02_00256981 predicted 1522
4 SASI_Rn02_00256982 predicted 1550
5 SASI_Rn02_00256983 predicted 1156
6 SASI_Rn02_00256984 predicted 1633
7 SASI_Rn02_00256985 predicted 1423
8 SASI_Rn02_00256986 predicted 1472
9 SASI_Rn02_00256987 predicted 1240
10 SASI_Rn02_00256988 predicted 1241
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080755 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293663 predicted 1661
2 SASI_Mm02_00293664 predicted 1932
3 SASI_Mm02_00293665 predicted 3056
4 SASI_Mm02_00293666 predicted 1432
5 SASI_Mm02_00293667 predicted 584
6 SASI_Mm02_00293668 predicted 1705
7 SASI_Mm02_00293669 predicted 847
8 SASI_Mm02_00293670 predicted 1584
9 SASI_Mm02_00293671 predicted 2806
10 SASI_Mm02_00293672 predicted 2172
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198416 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134970 predicted 1606
2 SASI_Mm01_00134972 predicted 1867
3 SASI_Mm02_00350965 predicted 2996
4 SASI_Mm01_00134973 predicted 1369
5 SASI_Mm01_00134974 predicted 531
6 SASI_Mm01_00134977 predicted 1652
7 SASI_Mm01_00134978 predicted 789
8 SASI_Mm01_00134979 predicted 1529
9 SASI_Mm02_00350966 predicted 2744
10 SASI_Mm02_00350967 predicted 2105
11 SASI_Mm01_00134971 predicted 1314
12 SASI_Mm01_00134975 predicted 987
13 SASI_Mm01_00134976 predicted 1106
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015534
VALIDATED
ZZZ3 MISSION shRNA Bacterial Glycerol Stock
zinc finger, ZZ-type containing 3
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015534.4-1023s21c1
Sequence:CCGGAGTGAGGAAGGGCCACTTAATCTCGAGATTAAGTGGCCCTTCCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376579    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015534.4-3499s21c1
Sequence:CCGGTCAAAGAACTTGGTCATAAATCTCGAGATTTATGACCAAGTTCTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015534.4-2168s21c1
Sequence:CCGGGATCGTATGGGACCAATATACCTCGAGGTATATTGGTCCCATACGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015534.4-3074s21c1
Sequence:CCGGTCACCAATTAGAACCTATTTACTCGAGTAAATAGGTTCTAATTGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015534.4-1586s21c1
Sequence:CCGGACCTCAAGAACATCGTTATACCTCGAGGTATAACGATGTTCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015534.4-485s21c1
Sequence:CCGGTTCCCGATCTACTCGTGTTACCTCGAGGTAACACGAGTAGATCGGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015534.4-1743s21c1
Sequence:CCGGGTAAGTCAATCTCCTACAAATCTCGAGATTTGTAGGAGATTGACTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015534.4-2668s21c1
Sequence:CCGGGACGACAGCACCCTCTTAATACTCGAGTATTAAGAGGGTGCTGTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015534.3-578s1c1
Sequence:CCGGCGCATCCTGAAGAAATCTCTTCTCGAGAAGAGATTTCTTCAGGATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015534.3-2803s1c1
Sequence:CCGGGCATCAGATGACGAAAGTATTCTCGAGAATACTTTCGTCATCTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133663    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015534.3-3593s1c1
Sequence:CCGGGCACAGAAACTGACTTCTTTACTCGAGTAAAGAAGTCAGTTTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015534.3-970s1c1
Sequence:CCGGCGATGTCTTATACTGGATGATCTCGAGATCATCCAGTATAAGACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015534.3-2167s1c1
Sequence:CCGGGAGATCGTATGGGACCAATATCTCGAGATATTGGTCCCATACGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015534.3-3146s1c1
Sequence:CCGGGTTACAATTACCTTGACCCAACTCGAGTTGGGTCAAGGTAATTGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134560    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015534.3-646s1c1
Sequence:CCGGGTGCCAATTCAGAAAGGAAATCTCGAGATTTCCTTTCTGAATTGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015534
VALIDATED
ZZZ3 MISSION shRNA shRNA Plasmid DNA
zinc finger, ZZ-type containing 3
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015534.4-1023s21c1
Sequence:CCGGAGTGAGGAAGGGCCACTTAATCTCGAGATTAAGTGGCCCTTCCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376579    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015534.4-3499s21c1
Sequence:CCGGTCAAAGAACTTGGTCATAAATCTCGAGATTTATGACCAAGTTCTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015534.4-2168s21c1
Sequence:CCGGGATCGTATGGGACCAATATACCTCGAGGTATATTGGTCCCATACGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015534.4-3074s21c1
Sequence:CCGGTCACCAATTAGAACCTATTTACTCGAGTAAATAGGTTCTAATTGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015534.4-1586s21c1
Sequence:CCGGACCTCAAGAACATCGTTATACCTCGAGGTATAACGATGTTCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015534.4-485s21c1
Sequence:CCGGTTCCCGATCTACTCGTGTTACCTCGAGGTAACACGAGTAGATCGGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015534.4-1743s21c1
Sequence:CCGGGTAAGTCAATCTCCTACAAATCTCGAGATTTGTAGGAGATTGACTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015534.4-2668s21c1
Sequence:CCGGGACGACAGCACCCTCTTAATACTCGAGTATTAAGAGGGTGCTGTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015534.3-578s1c1
Sequence:CCGGCGCATCCTGAAGAAATCTCTTCTCGAGAAGAGATTTCTTCAGGATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015534.3-2803s1c1
Sequence:CCGGGCATCAGATGACGAAAGTATTCTCGAGAATACTTTCGTCATCTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133663    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015534.3-3593s1c1
Sequence:CCGGGCACAGAAACTGACTTCTTTACTCGAGTAAAGAAGTCAGTTTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015534.3-970s1c1
Sequence:CCGGCGATGTCTTATACTGGATGATCTCGAGATCATCCAGTATAAGACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015534.3-2167s1c1
Sequence:CCGGGAGATCGTATGGGACCAATATCTCGAGATATTGGTCCCATACGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015534.3-3146s1c1
Sequence:CCGGGTTACAATTACCTTGACCCAACTCGAGTTGGGTCAAGGTAATTGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134560    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015534.3-646s1c1
Sequence:CCGGGTGCCAATTCAGAAAGGAAATCTCGAGATTTCCTTTCTGAATTGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015534
VALIDATED
ZZZ3 MISSION shRNA Lentiviral Transduction Particles
zinc finger, ZZ-type containing 3
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015534.4-1023s21c1
Sequence:CCGGAGTGAGGAAGGGCCACTTAATCTCGAGATTAAGTGGCCCTTCCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376579    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015534.4-3499s21c1
Sequence:CCGGTCAAAGAACTTGGTCATAAATCTCGAGATTTATGACCAAGTTCTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015534.4-2168s21c1
Sequence:CCGGGATCGTATGGGACCAATATACCTCGAGGTATATTGGTCCCATACGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015534.4-3074s21c1
Sequence:CCGGTCACCAATTAGAACCTATTTACTCGAGTAAATAGGTTCTAATTGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015534.4-1586s21c1
Sequence:CCGGACCTCAAGAACATCGTTATACCTCGAGGTATAACGATGTTCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015534.4-485s21c1
Sequence:CCGGTTCCCGATCTACTCGTGTTACCTCGAGGTAACACGAGTAGATCGGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015534.4-1743s21c1
Sequence:CCGGGTAAGTCAATCTCCTACAAATCTCGAGATTTGTAGGAGATTGACTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015534.4-2668s21c1
Sequence:CCGGGACGACAGCACCCTCTTAATACTCGAGTATTAAGAGGGTGCTGTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015534.3-578s1c1
Sequence:CCGGCGCATCCTGAAGAAATCTCTTCTCGAGAAGAGATTTCTTCAGGATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015534.3-2803s1c1
Sequence:CCGGGCATCAGATGACGAAAGTATTCTCGAGAATACTTTCGTCATCTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133663    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015534.3-3593s1c1
Sequence:CCGGGCACAGAAACTGACTTCTTTACTCGAGTAAAGAAGTCAGTTTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015534.3-970s1c1
Sequence:CCGGCGATGTCTTATACTGGATGATCTCGAGATCATCCAGTATAAGACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015534.3-2167s1c1
Sequence:CCGGGAGATCGTATGGGACCAATATCTCGAGATATTGGTCCCATACGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015534.3-3146s1c1
Sequence:CCGGGTTACAATTACCTTGACCCAACTCGAGTTGGGTCAAGGTAATTGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134560    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015534.3-646s1c1
Sequence:CCGGGTGCCAATTCAGAAAGGAAATCTCGAGATTTCCTTTCTGAATTGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198416
VALIDATED
ZZZ3 MISSION shRNA Bacterial Glycerol Stock
zinc finger, ZZ-type containing 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000336254    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198416.2-3324s21c1
Sequence:CCGGTTGTAGGTGGTGGTGTTAAATCTCGAGATTTAACACCACCACCTACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198416.2-1259s21c1
Sequence:CCGGTACCTGTGGAACGACGAAATCCTCGAGGATTTCGTCGTTCCACAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198416.2-408s21c1
Sequence:CCGGTTCCCGATCTACTCGTGTTACCTCGAGGTAACACGAGTAGATCGGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198416.2-946s21c1
Sequence:CCGGAGTGAGGAAGGGCCACTTAATCTCGAGATTAAGTGGCCCTTCCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198416.2-2540s21c1
Sequence:CCGGCAGGCAGAACACCTAACTTATCTCGAGATAAGTTAGGTGTTCTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198416.1-1775s1c2
Sequence:CCGGCCAGAGTGAATATTGGACATTCTCGAGAATGTCCAATATTCACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198416.1-2537s1c1
Sequence:CCGGCAGGCAGAACACCTAACTTATCTCGAGATAAGTTAGGTGTTCTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198416.1-2613s1c1
Sequence:CCGGCCTCTTTAAACCTTCCACTTTCTCGAGAAAGTGGAAGGTTTAAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198416.1-2011s1c1
Sequence:CCGGCCTATTGGATTTGTGGAGAAACTCGAGTTTCTCCACAAATCCAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198416
VALIDATED
ZZZ3 MISSION shRNA shRNA Plasmid DNA
zinc finger, ZZ-type containing 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000336254    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198416.2-3324s21c1
Sequence:CCGGTTGTAGGTGGTGGTGTTAAATCTCGAGATTTAACACCACCACCTACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198416.2-1259s21c1
Sequence:CCGGTACCTGTGGAACGACGAAATCCTCGAGGATTTCGTCGTTCCACAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198416.2-408s21c1
Sequence:CCGGTTCCCGATCTACTCGTGTTACCTCGAGGTAACACGAGTAGATCGGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198416.2-946s21c1
Sequence:CCGGAGTGAGGAAGGGCCACTTAATCTCGAGATTAAGTGGCCCTTCCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198416.2-2540s21c1
Sequence:CCGGCAGGCAGAACACCTAACTTATCTCGAGATAAGTTAGGTGTTCTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198416.1-1775s1c2
Sequence:CCGGCCAGAGTGAATATTGGACATTCTCGAGAATGTCCAATATTCACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198416.1-2537s1c1
Sequence:CCGGCAGGCAGAACACCTAACTTATCTCGAGATAAGTTAGGTGTTCTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198416.1-2613s1c1
Sequence:CCGGCCTCTTTAAACCTTCCACTTTCTCGAGAAAGTGGAAGGTTTAAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198416.1-2011s1c1
Sequence:CCGGCCTATTGGATTTGTGGAGAAACTCGAGTTTCTCCACAAATCCAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198416
VALIDATED
ZZZ3 MISSION shRNA Lentiviral Transduction Particles
zinc finger, ZZ-type containing 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000336254    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198416.2-3324s21c1
Sequence:CCGGTTGTAGGTGGTGGTGTTAAATCTCGAGATTTAACACCACCACCTACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198416.2-1259s21c1
Sequence:CCGGTACCTGTGGAACGACGAAATCCTCGAGGATTTCGTCGTTCCACAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198416.2-408s21c1
Sequence:CCGGTTCCCGATCTACTCGTGTTACCTCGAGGTAACACGAGTAGATCGGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198416.2-946s21c1
Sequence:CCGGAGTGAGGAAGGGCCACTTAATCTCGAGATTAAGTGGCCCTTCCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198416.2-2540s21c1
Sequence:CCGGCAGGCAGAACACCTAACTTATCTCGAGATAAGTTAGGTGTTCTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198416.1-1775s1c2
Sequence:CCGGCCAGAGTGAATATTGGACATTCTCGAGAATGTCCAATATTCACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198416.1-2537s1c1
Sequence:CCGGCAGGCAGAACACCTAACTTATCTCGAGATAAGTTAGGTGTTCTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198416.1-2613s1c1
Sequence:CCGGCCTCTTTAAACCTTCCACTTTCTCGAGAAAGTGGAAGGTTTAAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198416.1-2011s1c1
Sequence:CCGGCCTATTGGATTTGTGGAGAAACTCGAGTTTCTCCACAAATCCAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks