EC Number 231-791-2
Popular Documents: Bulletin (PDF)
| Related Categories | CE-COL, Functional Genomics and RNAi, MISSION esiRNA Technology, Mouse esiRNA |
| description | Powered by Eupheria Biotech |
| concentration | 200 ng/μL RNA |
| esiRNA cDNA target sequence |
CCATCAAGAGCTCCTTCCAGCCGTG |
| Ensembl accession no. |
ENSMUSG00000041491 |
| NCBI accession no. |
NM_198019 |
| shipped in | dry ice |
| storage temp. | −20°C |
MISSION esiRNA are endo-ribonuclease prepared siRNA. MISSION esiRNA are a heterogeneous mixture of siRNAs that all target the same mRNA sequence. These multiple silencing triggers lead to highly specific and effective gene silencing.
esiRNA Custom options:
ESISEC: Secondary independent esiRNA for any human or mouse esiRNA
ESIOPEN: Custom esiRNA targeting species specific sequence provided
Contact your local sales rep. or email us at Custom esiRNA
for more information.
View the esiRNA screening tutorial
Solution in low-TE (Tris-HCl (10 mM final), EDTA (1 mM final), pH to 8.0.
MISSION is a registered trademark of Sigma-Aldrich Co. LLC
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Need larger quantities for your development, manufacturing or research applications?