MISSION® miRNA, Negative Control 2
Sequence from Caenorhabditis elegans with no homology to human gene sequences
DOWNLOAD MSDS (PDF)Synonym: Mature Sequence: CGGUACGAUCGCGGCGGGAUAUC
-
Popular Documents: Bulletin (PDF)
Properties
| Related Categories | Functional Genomics and RNAi, miRNA, miRNA negative controls More... |
| storage temp. | −20°C |
Description
General description
MISSION® miRNA Negative Controls are an essential component to any miRNA experiment. Using a negative control allows the researcher to create a baseline for mRNA knockdown effciency. The negative controls have been carefully selected, and have no known homology to known human gene sequences. Negative Control 2 is based upon a Caenorhabditis elegans sequence.
Legal Information
MISSION is a registered trademark of Sigma-Aldrich Co. LLC
Price and Availability
Customers Also Viewed
Human MIR17 (NR_029487)
Sequence from Arabidopsis thaliana with no homology to human gene sequences
Technical Service:
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Bulk Ordering & Pricing:
Need larger quantities for your development, manufacturing or research applications?
