Synonym: hsa-miR-26b-5p
miRNA ID hsa-mir-26b Sanger Database
Popular Documents: Bulletin (PDF)
| Related Categories | Functional Genomics and RNAi, miRNA, miRNA mimics hsa-let-000 to hsa-miR-430 More... |
| mature sequence | UUCAAGUAAUUCAGGAUAGGU |
| Sanger mature/minor accession no. |
MIMAT0000083 |
| Sanger microRNA accession no. |
MI0000084 |
| storage temp. | −20°C |
The ready-to-use MISSION miRNA mimics are small, double-stranded RNA molecules designed to mimic endogenous mature miRNA molecules when introduced into cells. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation. MISSION miRNA Mimics, a member of MISSION RNAi product family, provides miRNA researchers with a range of options from individual MISSION mimics to a full library of human miRNA mimics based on latest version from the Sanger Institute.
• Optimized and ready for transfection
• Novel MISSION miRNA mimic design has been functionally tested for knockdown efficiency against natural miRNA targets
• Unique MISSION miRNA mimic design significantly reduces possible sense strand off target effects
• Available as a whole human library and individual miRNA targets
miRBase V18 Mature ID update: hsa-miR-26b-5p
MISSION is a registered trademark of Sigma-Aldrich Co. LLC
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Need larger quantities for your development, manufacturing or research applications?