MISSION® microRNA Mimic
hsa-miR-92a
DOWNLOAD MSDS (PDF)Synonym: hsa-miR-92a-3p
-
miRNA ID hsa-mir-92a-2 Sanger Database
-
Popular Documents: Bulletin (PDF)
Properties
| Related Categories | Functional Genomics and RNAi, miRNA, miRNA mimics hsa-let-000 to hsa-miR-430 More... |
| mature sequence | UAUUGCACUUGUCCCGGCCUGU |
| Sanger mature/minor accession no. |
MIMAT0000092
|
| Sanger microRNA accession no. |
MI0000094
|
| storage temp. | −20°C |
| Gene Information | human ... hsa-miR-92a(407049) |
Description
General description
The ready-to-use MISSION miRNA mimics are small, double-stranded RNA molecules designed to mimic endogenous mature miRNA molecules when introduced into cells. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation. MISSION miRNA Mimics, a member of MISSION RNAi product family, provides miRNA researchers with a range of options from individual MISSION mimics to a full library of human miRNA mimics based on latest version from the Sanger Institute.
• Optimized and ready for transfection
• Novel MISSION miRNA mimic design has been functionally tested for knockdown efficiency against natural miRNA targets
• Unique MISSION miRNA mimic design significantly reduces possible sense strand off target effects
• Available as a whole human library and individual miRNA targets
Other Notes
miRBase V18 Mature ID update: hsa-miR-92a-3p
Legal Information
MISSION is a registered trademark of Sigma-Aldrich Co. LLC
Price and Availability
Technical Service:
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Bulk Ordering & Pricing:
Need larger quantities for your development, manufacturing or research applications?
