HMI0089 Sigma

MISSION® microRNA Mimic

hsa-miR-1243

DOWNLOAD MSDS (PDF)

Properties

Related Categories Functional Genomics and RNAi, miRNA, miRNA mimics hsa-miR-1001 to hsa-miR-3700 More...
mature sequence   AACUGGAUCAAUUAUAGGAGUG
Sanger mature/minor accession no.   MIMAT0005894
Sanger microRNA accession no.   MI0006373
storage temp.   −20°C

Description

General description

The ready-to-use MISSION miRNA mimics are small, double-stranded RNA molecules designed to mimic endogenous mature miRNA molecules when introduced into cells. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation. MISSION miRNA Mimics, a member of MISSION RNAi product family, provides miRNA researchers with a range of options from individual MISSION mimics to a full library of human miRNA mimics based on latest version from the Sanger Institute.

• Optimized and ready for transfection
• Novel MISSION miRNA mimic design has been functionally tested for knockdown efficiency against natural miRNA targets
• Unique MISSION miRNA mimic design significantly reduces possible sense strand off target effects
• Available as a whole human library and individual miRNA targets

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

Price and Availability

Technical Service:

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Bulk Ordering & Pricing:

Need larger quantities for your development, manufacturing or research applications?