HUTR01742 Sigma

MISSION® 3′UTR Lenti GoClone

Powered by SwitchGear Genomics, 3′UTR, human, C10orf93

DOWNLOAD MSDS (PDF)

Synonym: HUTR

Properties

Related Categories BN-C11, Functional Genomics and RNAi, MISSION 3′UTR Lenti GoClone, powered by SwitchGear Genomics More...
description   Functional Validation of miRNA Gene Targets
human 3′UTR sequence   ccacagcaccacagttgtttctagagtccaatttacggacggcgtaaaatttcatgatgctgatgatccagaacatcctccaccagtcccattattggacgtgtaaatcacaccggcagtgcctcgttacccgcagttcactttctgcagtttgttacctgcagacagctacagtatgaaaatattaagctattctgagggagaggccacagccacatcacttctgttacagtatagtgttatgattgtatctta (3′UTR sequences are truncated after the first 255 bases)
NCBI accession no.   NM_173572
shipped in   dry ice
storage temp.   −70°C
Gene Information   human ... C10orf93(255352)

Description

Application

To see more application data, protocols, and vector maps visit www.sigma.com/3utr.

Legal Information

Use of this product is subject to one or more license agreements. For details, please see www.sigmaaldrich.com/missionlicense.

GoClone is a trademark of SwitchGear Genomics

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

SwitchGear Genomics is a trademark of SwitchGear Genomics

Physical form

200 μL of at least 105 TU/mL (via p24 titering assay) lentiviral particles are provided as frozen stock.

Price and Availability

Technical Service:

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Bulk Ordering & Pricing:

Need larger quantities for your development, manufacturing or research applications?