EMAIL THIS PAGE TO A FRIEND
EHU007471 Sigma

MISSION® esiRNA

esiRNA targeting human ST6GALNAC5 (esiRNA1)

Purchase

Properties

Related Categories Functional Genomics and RNAi, Human esiRNA, MISSION esiRNA Technology, Molecular Biology, SP-SV More...
description   Powered by Eupheria Biotech
concentration   200 ng/μL RNA
esiRNA cDNA target sequence   TTACTCGCCACAAGATGCTGCAGTTTGATGAGCTCTTCAAGCAGGAGACTGGCAAAGACAGGAAGATATCCAACACTTGGCTCAGCACTGGCTGGTTTACAATGACAATTGCACTGGAGCTCTGTGACAGGATCAATGTTTATGGCATGGTGCCCCCAGACTTCTGCAGGGATCCCAATCACCCTTCAGTACCTTATCATTATTATGAACCTTTTGGACCTGATGAATGTACAATGTACCTCTCCCATGAGCGAGGACGCAAGGGCAGTCATCACCGCTTTATCACAGAGAAACGAGTCTTTAAGAACTGGGCACGGACATTCAATATTCACTTTTTTCAACCAGACTGGAAACCAGAATCACTTGCTATAAATCATCCTGAGAATAAACCTGTGTTCTAAGGAATGAGCATGCCAGACTGTAATCCCAGGTATTCACTGCATCAGACACCGAGACACTGAACTTCCTGAGCCACCAGACAGGAAAGGGTAGCAGAAAACAGCTTCACTCCTCAGGAAGTACCATGGACAGACGCC
Ensembl | human accession no.   ENSG00000117069
NCBI accession no.   NM_030965
shipped in   dry ice
storage temp.   −20°C
Gene Information   human ... ST6GALNAC5(81849)

Description

General description

MISSION esiRNA are endo-ribonuclease prepared siRNA. MISSION esiRNA are a heterogeneous mixture of siRNAs that all target the same mRNA sequence. These multiple silencing triggers lead to highly specific and effective gene silencing.

esiRNA Custom options:
ESISEC: Secondary independent esiRNA for any human or mouse esiRNA
ESIOPEN: Custom esiRNA targeting species specific sequence provided
Contact your local sales rep. or email us at Custom esiRNA for more information.

Other Notes

View the esiRNA screening tutorial.

Physical form

Solution in low-TE (10 mM Tris-HCl, pH 8.0, 1 mM EDTA)

Biochem/physiol Actions

ST6GALNAC5 (α-N-acetylgalactosaminide α-2,6-sialyltransferase 5) participates in the biosynthesis of α-series gangliosides. It is linked with breast cancer metastasis to the brain. ST6GALNAC5 reduces the association between breast cancer cells and human blood brain barrier. Mutations in this gene are associated with coronary artery disease.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

Price and Availability

Safety & Documentation

Safety Information

RIDADR 
NONH for all modes of transport
Protocols & Articles
Peer-Reviewed Papers
15

References

Related Products

Technical Service:

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Bulk Ordering & Pricing:

Need larger quantities for your development, manufacturing or research applications?