EMAIL THIS PAGE TO A FRIEND
EMU024261 Sigma

MISSION® esiRNA

esiRNA targeting mouse Pdgfc (esiRNA1)

Purchase

Properties

Related Categories Functional Genomics and RNAi, MISSION esiRNA Technology, Molecular Biology, Mouse esiRNA, PB-PIG More...
description   Powered by Eupheria Biotech
concentration   200 ng/μL RNA
esiRNA cDNA target sequence   TGGTGCTGGTGTGGAGATTAGTTGCAGTAGATGAAAATGTGCGGATCCAGCTGACATTTGATGAGAGATTTGGGCTGGAAGATCCAGAAGACGATATATGCAAGTATGATTTTGTAGAAGTTGAGGAGCCCAGTGATGGAAGTGTTTTAGGACGCTGGTGTGGTTCTGGGACTGTGCCAGGAAAGCAGACTTCTAAAGGAAATCATATCAGGATAAGATTTGTATCTGATGAGTATTTTCCATCTGAACCCGGATTCTGCATCCACTACAGTATTATCATGCCACAAGTCACAGAAACCACGAGTCCTTCGGTGTTGCCCCCTTCATCTTTGTCATTGGACCTGCTCAACAATGCTGTGACTGCCTTCAGTACCTTGGAAGAGCTGATTCGGTACCTAGAGCCAGATCGATGGCAGGTGGACTTGGACAGCCTCTACAAGCCAACATGGCA
Ensembl | mouse accession no.   ENSMUSG00000028019
NCBI accession no.   NM_019971
shipped in   dry ice
storage temp.   −20°C
Gene Information   mouse ... Pdgfc(54635)

Description

General description

MISSION esiRNA are endo-ribonuclease prepared siRNA. MISSION esiRNA are a heterogeneous mixture of siRNAs that all target the same mRNA sequence. These multiple silencing triggers lead to highly specific and effective gene silencing.

esiRNA Custom options:
ESISEC: Secondary independent esiRNA for any human or mouse esiRNA
ESIOPEN: Custom esiRNA targeting species specific sequence provided
Contact your local sales rep. or email us at Custom esiRNA for more information.

Other Notes

View the esiRNA screening tutorial

Physical form

Solution in low-TE (Tris-HCl (10 mM final), EDTA (1 mM final), pH to 8.0.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

Price and Availability

Safety & Documentation

Safety Information

RIDADR 
NONH for all modes of transport
Protocols & Articles
Related Products

Technical Service:

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Bulk Ordering & Pricing:

Need larger quantities for your development, manufacturing or research applications?