• USA Home
  • HLMIR2304 - MISSION® Lenti microRNA, Human

EMAIL THIS PAGE TO A FRIEND
HLMIR2304 Sigma

MISSION® Lenti microRNA, Human

hsa-miR-579-5p

Purchase

Properties

Related Categories Functional Genomics and RNAi, Human Lenti microRNA, MISSION Lenti microRNA, Molecular Biology, hsa-miR-546 to hsa-miR-1200 More...
mature sequence   UCGCGGUUUGUGCCAGAUGACG
Sanger mature/minor accession no.   MIMAT0026616
Sanger microRNA accession no.   MI0003586
shipped in   dry ice
storage temp.   −70°C

Description

Other Notes

Based on miRBase V20 Mature ID

General description

Sigma’s Mission Lenti-miRs express miRNAs from a common backbone, whose structure meets requirements for accurate Dicer processing and a partially complementary strand is designed to mimic the base pairing pattern in the backbone structure using a proprietary algorithm. Oligos containing the microRNA sequences are cloned into the TRC2-pLKO-puro vector. Each miRNA construct has been cloned and sequence verified. Mature microRNA sequences are obtained from miRBase.

Lentiviral transduction particles are produced from sequence-verified lentiviral plasmid vectors. Oligos containing the microRNA sequences are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells. The polymerase II promoter, elongation factor 1 alpha (EF1A), was chosen to drive miRNA expression needed for reverse transcription of viral RNA and integration of viral DNA into the host cell genome. Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory element allowing for enhanced expression of transgenes delivered by lentiviral vectors. This lentiviral vector also carries a puromycin resistance gene for selection of cells. Unlike murine-based MMLV or MSCV retroviral systems, lentiviral-based particles permit efficient infection and integration of the specific miRNA construct into differentiated and non-dividing cells, such as neurons and dendritic cells.

Recommended products

Two negative controls are available: NCLMIR001 and NCLMIR002

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

Price and Availability

Safety & Documentation

Safety Information

RIDADR 
UN 3245 9
WGK Germany 
3
Protocols & Articles
Related Products

control

Product #

Description

Add to Cart

NCLMIR002 MISSION® Lenti microRNA, Human, Negative Control 2
NCLMIR001 MISSION® Lenti microRNA, Human, Negative Control 1

Technical Service:

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Bulk Ordering & Pricing:

Need larger quantities for your development, manufacturing or research applications?