• USA Home
  • HMC0002 - MISSION® miRNA, Negative Control 1

EMAIL THIS PAGE TO A FRIEND
HMC0002 Sigma

MISSION® miRNA, Negative Control 1

Sequence from Arabidopsis thaliana with no homology to human gene sequences

Synonym: Mature Sequence: GGUUCGUACGUACACUGUUCA

Purchase

Properties

Related Categories Functional Genomics and RNAi, Molecular Biology, miRNA, miRNA negative controls
storage temp.   −20°C

Description

General description

MISSION® miRNA Negative Controls are an essential component to any miRNA experiment. Using a negative control allows the researcher to create a baseline for mRNA knockdown effciency. The negative controls have been carefully selected, and have no known homology to known human gene sequences. Negative Control 1 is based upon a Arabidopsis thaliana sequence.

Application

MISSION® miRNA, Negative Control 1 has been used as a negative control for miRNA transfections.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

Price and Availability

Safety & Documentation

Safety Information

RIDADR 
NONH for all modes of transport
WGK Germany 
3
Protocols & Articles
Peer-Reviewed Papers
15

References

Related Products

related product

Product #

Description

Add to Cart

06693 Timestrip Plus -20 °C

Technical Service:

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Bulk Ordering & Pricing:

Need larger quantities for your development, manufacturing or research applications?