• USA Home
  • HMI0995 - MISSION® microRNA Mimic

EMAIL THIS PAGE TO A FRIEND
HMI0995 Sigma

MISSION® microRNA Mimic

hsa-mir-670

Purchase

Properties

Related Categories Functional Genomics and RNAi, Molecular Biology, miRNA, miRNA mimics: hsa-miR-546 to hsa-miR-1200
mature sequence   GUCCCUGAGUGUAUGUGGUG
Sanger mature/minor accession no.   MIMAT0010357
Sanger microRNA accession no.   MI0003933
storage temp.   −20°C
Gene Information   human ... hsa-miR-670(100313777)

Description

General description

The ready-to-use MISSION miRNA mimics are small, double-stranded RNA molecules designed to mimic endogenous mature miRNA molecules when introduced into cells. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation. MISSION miRNA Mimics, a member of MISSION RNAi product family, provides miRNA researchers with a range of options from individual MISSION mimics to a full library of human miRNA mimics based on latest version of miRBase (currently hosted by the University of Manchester, previously hosted by the Sanger Institute).

• Optimized and ready for transfection.
• Novel MISSION miRNA mimic design has been functionally tested for knockdown efficiency against natural miRNA targets.
• Unique MISSION miRNA mimic design significantly reduces possible sense strand off target effects.
• Available as a whole human library and individual miRNA targets.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

Price and Availability

Safety & Documentation

Safety Information

RIDADR 
NONH for all modes of transport
WGK Germany 
3
Protocols & Articles
Related Products

Technical Service:

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Bulk Ordering & Pricing:

Need larger quantities for your development, manufacturing or research applications?