• USA Home
  • MLTUD0660 - MISSION® Lenti microRNA Inhibitor, Mouse

EMAIL THIS PAGE TO A FRIEND
MLTUD0660 Sigma

MISSION® Lenti microRNA Inhibitor, Mouse

mmu-miR-499-5p

Synonym: Tough Decoy, TuD

Purchase

Properties

Related Categories Functional Genomics and RNAi, MISSION Lenti microRNA Inhibitors, Molecular Biology, Mouse Lenti microRNA Inhibitors, mmu-miR-341 to mmu-miR-670 More...
mature sequence   UUAAGACUUGCAGUGAUGUUU
Sanger mature/minor accession no.   MIMAT0003482
microRNA accession no.   MI0004676
shipped in   dry ice
storage temp.   −70°C

Description

Other Notes

Based on miRBase V19 Mature ID

General description

Individual lenti microRNA inhibitors are designed using a proprietary algorithm, which is based on the work of Haraguchi, T, et al. and in collaboration with Dr. Hideo Iba, University of Tokyo. This algorithm utilizes the tough decoy (TuD) design. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation. The lentiviral microRNA Inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells. Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element2 (WPRE) is included, allowing for enhanced expression of transgenes delivered by lentiviral vectors. This lentiviral vector also carries a puromycin resistance gene for selection of cells.

Allows for potent inhibition of the desired miRNA
Lentiviral delivery format allows for efficient delivery of the inhibitor into a wide variety of cell types
Enables long-term inhibition without repeat transfection

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

Price and Availability

Safety & Documentation

Safety Information

RIDADR 
UN 3245 9
WGK Germany 
3

Documents

Certificate of Analysis

Protocols & Articles
Related Products

Technical Service:

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Bulk Ordering & Pricing:

Need larger quantities for your development, manufacturing or research applications?