Website Help System

Oligo Copy/Paste Ordering Interface

Ordering DNA Oligos – Modified & Non-Modified

  • Select the product type and file format from the drop down menu
  • Format Your Sequences

  MS Excel Format (Tab Delimited): Column A = Oligo Name, Column B = Sequence, Column C = Scale (or Fixed OD),
Column D = Purification, Column E = Special Instructions (Optional)

Example:
   
My Oligo1 [A488]AACGTACGTACGTACGTACGT 0.2 HPLC
My Oligo2 ACGTACGTACGTACGTACGTACGT 0.2 HPLC
My Oligo3 ACGTACGTACGTACGTACGTACGTT 0.2 HPLC
     
  csv file Format (Comma Separated): Oligo Name, Sequence, Scale (or Fixed OD), Purification, Special Instructions (Optional)
     
    Example:
My Oligo1, [A488]AACGTACGTACGTACGTACGT,0.2,HPLC
My Oligo2, ACGTACGTACGTACGTACGTACGT,0.2,HPLC
My Oligo3, ACGTACGTACGTACGTACGTACGTT,0.2,HPLC
  • Define the product packaging by selecting “Tubes” in the drop down menu
  • Items can be added to your shopping cart by clicking Add to Cart

Ordering Multiple Types of Oligos in One Upload (Example: Primers & Probes)

  • Select "Defined in Data—Supports multiple types in one upload" from the drop down menu
  • Select file format from the drop down menu
  • Format Your Sequences
  MS Excel Format (Tab Delimited): Column A = Oligo Type Code, Column B = Oligo Name, Column C = Sequence, Column D = Scale (or Fixed OD), Column E = Purification, Column F = Special Instructions (Optional)

Note: The Oligo Type Code can be found in the table below titled “Product Type Description” or in the excel download template.

Example:
   
STD My Oligo1 [A488]AACGTACGTACGTACGTACGT 0.2 HPLC
STD My Oligo2 ACGTACGTACGTACGTACGTACGT 0.2 HPLC
DLFP My Probe1 [6FAM]ACGTACGTACGTACGTACGT[BHQ1] 1 HPLC
DLFP My Probe2 [HEX] ACGTACGTACGTACGTACGT[BHQ1] 3 HPLC
     
  csv file Format (Comma Separated): Oligo Type Code, Oligo Name, Sequence, Scale (or Fixed OD), Purification, Special Instructions (Optional)

Note: The Oligo Type Code can be found in the table below titled “Product Type Description” or in the excel download template.

Example:
STD,My Oligo1,[A488]AACGTACGTACGTACGTACGT,0.2,HPLC
STD,My Oligo2, ACGTACGTACGTACGTACGTACGT,0.2,HPLC
DLFP, My Probe1, [6FAM]ACGTACGTACGTACGTACGT[BHQ1],1,HPLC
DLFP, My Probe2, [HEX] ACGTACGTACGTACGTACGT[BHQ1],3,HPLC
  • Define the product packaging by selecting “Tubes” in the drop down menu
  • Items can be added to your shopping cart by clicking Add to Cart.

Ordering Codes

 
Product Type Description Oligo Type Code
DNA Oligos - modified and non-modified
STD
Dual-Labeled Probes DLFP
Molecular Beacon MB
F@ST F@STSTOLIGO
E@SY E@SYOLIGO
WellRED WELLRED
Pure and Simple Primer PSP
Scale of Synthesis Description Scale Code
0.025 µmol
0.025
0.05 µmol 0.05
0.2 µmol 0.2
1 µmol 1
10 µmol 10
15 µmol 15
Fixed OD Description (Probes) Fixed OD Code
1 OD 1
3 OD 3
5 OD 5
10 OD 10
50 OD 50
100 OD 100
Purification Description Purification Code
Desalt DST
Reverse Phase Cartridge Purification RP1
HPLC HPLC
PAGE PAGE
5' Modification Description 5' Mod Code
Alexa Fluor® 488 [A488]
Alexa Fluor® 546 [A546]
5'Amine C12 [AmC12]
Amine C6 TFA (Desalt, PAGE) [AmC6F]
5' Amino C6 MMT (RP1, HPLC) [AmC6T]
Biotin [Btn]
Biotin TEG [BtnTg]
5-Bromo dC [5BrdC]
5-Bromo dU [5BrdU]
8-Bromo dA [8BrdA]
8-Bromo dG [8BrdG]
Carboxy-Rhodamine 6GTM [CRh6G]
Cyanine3 [Cyanine3]
Cyanine5 [Cyanine5]
Cyanine5.5 [Cyanine55]
deoxyInosine I
deoxyUridine U
Digoxigenin [DIG]
6-FAM™ [6FAM]
Fluorescein [Flc]
HEX™ [HEX]
JOE™ [JOE]
5' Phosphorylation [Phos]
ROX™ [ROX]
TAMRA™ [TAM]
TET™ [TET]
Texas Red® [TxRd]
Thiol C6 S-S [ThiC6]
WellRED D2-PA [D2-PA]
WellRED D3-PA [D3-PA]
WellRED D4-PA [D4-PA]
SPECIAL (Please define) [SPECIAL]
Base/IUB Redundancy Description Base/IUB Code
A (adenine) A
C (cytosine) C
G (guanine) G
T (thymine) T
Phosphorothioate linkages *
2'O-Methyl RNA [mA], [mG], [mC], [mU]
LNA Bases (Note: only used with dual-labeled probes) [+A], [+G], [+C], [+T]
DNA bases within RNA oligos [dA], [dC], [dG], [dT]
B = G+T+C B
D = G+A+T D
H = A+T+C H
K = G+T K
M = A+C M
N = A+C+G+T N
R = A+G R
S = G+C S
V = A+C+G V
W = A+T W
Y = C+T Y
Internal Modification Description Internal Mod Code
Amino C2 dT [AmC2T]
Amino C6 dT [AmC6T]
Biotin TEG [BtnTg]
Biotin dT [BtndT]
5-Bromo dC [5BrdC]
5-Bromo dU [5BrdU]
8-Bromo dA [8BrdA]
8-Bromo dG [8BrdG]
deoxylnosine I
deoyxUridine U
Fluorescein dT [FlcdT]
5 Methyl dC [5MedC]
SPECIAL (Please define) [SPECIAL]
3' Modification Description 3' Mod Code
Alexa Fluor® 488 [A488]
Alexa Fluor® 546 [A546]
3'Amine C3 [AmC3]
3'Amine C7 [AmC7]
BHQ-1™ (Probe) [BHQ1]
BHQ-2™ (Probe) [BHQ2]
Biotin TEG [BtnTg]
Cyanine3 [Cyanine3]
Cyanine5 [Cyanine5]
Dabcyl (Probe) [DABC]
deoxyInosine I
deoxyUridine U
Digoxigenin [DIG]
Fluorescein [Flc]
JOE™ [JOE]
Onyx Quencher™ A [OQA]
Onyx Quencher™ B [OQB]
Onyx Quencher™ C [OQC]
Onyx Quencher™ D [OQD]
3' Phosphorylation [Phos]
ROX™ [ROX]
Spacer C3 [SpcC3]
TAMRA™ [TAM]
Texas Red® [TxRd]
Thiol C3 [ThiC3]
SPECIAL (Please define) [SPECIAL]