Attention:

Certain features of Sigma-Aldrich.com will be down for maintenance the evening of Friday August 18th starting at 8:00 pm CDT until Saturday August 19th at 12:01 pm CDT.   Please note that you still have telephone and email access to our local offices. We apologize for any inconvenience.

shRNA Design

pLKO.1 Sequence

ttggggttgcgccttttccaaggcagccctgggtttgcgcagggacgcgg
ctgctctgggcgtggttccgggaaacgcagcggcgccgaccctgggtctc
gcacattcttcacgtccgttcgcagcgtcacccggatcttcgccgctacc
cttgtgggccccccggcgacgcttcctgctccgcccctaagtcgggaagg
ttccttgcggttcgcggcgtgccggacgtgacaaacggaagccgcacgtc
tcactagtaccctcgcagacggacagcgccagggagcaatggcagcgcgc
cgaccgcgatgggctgtggccaatagcggctgctcagcagggcgcgccga
gagcagcggccgggaaggggcggtgcgggaggcggggtgtggggcggtag
tgtgggccctgttcctgcccgcgcggtgttccgcattctgcaagcctccg
gagcgcacgtcggcagtcggctccctcgttgaccgaatcaccgacctctc
tccccagggggatccaccggagcttaccatgaccgagtacaagcccacgg
tgcgcctcgccacccgcgacgacgtccccagggccgtacgcaccctcgcc
gccgcgttcgccgactaccccgccacgcgccacaccgtcgatccggaccg
ccacatcgagcgggtcaccgagctgcaagaactcttcctcacgcgcgtcg
ggctcgacatcggcaaggtgtgggtcgcggacgacggcgccgcggtggcg
gtctggaccacgccggagagcgtcgaagcgggggcggtgttcgccgagat
cggcccgcgcatggccgagttgagcggttcccggctggccgcgcagcaac
agatggaaggcctcctggcgccgcaccggcccaaggagcccgcgtggttc
ctggccaccgtcggcgtctcgcccgaccaccagggcaagggtctgggcag
cgccgtcgtgctccccggagtggaggcggccgagcgcgccggggtgcccg
ccttcctggagacctccgcgccccgcaacctccccttctacgagcggctc
ggcttcaccgtcaccgccgacgtcgaggtgcccgaaggaccgcgcacctg
gtgcatgacccgcaagcccggtgcctgacgcccgccccacgacccgcagc
gcccgaccgaaaggagcgcacgaccccatgcatcggtacctttaagacca
atgacttacaaggcagctgtagatcttagccactttttaaaagaaaaggg
gggactggaagggctaattcactcccaacgaagacaagatctgctttttg
cttgtactgggtctctctggttagaccagatctgagcctgggagctctct
ggctaactagggaacccactgcttaagcctcaataaagcttgccttgagt
gcttcaagtagtgtgtgcccgtctgttgtgtgactctggtaactagagat
ccctcagacccttttagtcagtgtggaaaatctctagcagtagtagttca
tgtcatcttattattcagtatttataacttgcaaagaaatgaatatcaga
gagtgagaggaacttgtttattgcagcttataatggttacaaataaagca
atagcatcacaaatttcacaaataaagcatttttttcactgcattctagt
tgtggtttgtccaaactcatcaatgtatcttatcatgtctggctctagct
atcccgcccctaactccgcccatcccgcccctaactccgcccagttccgc
ccattctccgccccatggctgactaattttttttatttatgcagaggccg
aggccgcctcggcctctgagctattccagaagtagtgaggaggctttttt
ggaggcctagggacgtacccaattcgccctatagtgagtcgtattacgcg
cgctcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgt
tacccaacttaatcgccttgcagcacatccccctttcgccagctggcgta
atagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctg
aatggcgaatgggacgcgccctgtagcggcgcattaagcgcggcgggtgt
ggtggttacgcgcagcgtgaccgctacacttgccagcgccctagcgcccg
ctcctttcgctttcttcccttcctttctcgccacgttcgccggctttccc
cgtcaagctctaaatcgggggctccctttagggttccgatttagtgcttt
acggcacctcgaccccaaaaaacttgattagggtgatggttcacgtagtg
ggccatcgccctgatagacggtttttcgccctttgacgttggagtccacg
ttctttaatagtggactcttgttccaaactggaacaacactcaaccctat
ctcggtctattcttttgatttataagggattttgccgatttcggcctatt
ggttaaaaaatgagctgatttaacaaaaatttaacgcgaattttaacaaa
atattaacgcttacaatttaggtggcacttttcggggaaatgtgcgcgga
acccctatttgtttatttttctaaatacattcaaatatgtatccgctcat
gagacaataaccctgataaatgcttcaataatattgaaaaaggaagagta
tgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattt
tgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgc
tgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaaca
gcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatg
agcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgc
cgggcaagagcaactcggtcgccgcatacactattctcagaatgacttgg
ttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagta
agagaattatgcagtgctgccataaccatgagtgataacactgcggccaa
cttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgc
acaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctg
aatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaat
ggcaacaacgttgcgcaaactattaactggcgaactacttactctagctt
cccggcaacaattaatagactggatggaggcggataaagttgcaggacca
cttctgcgctcggcccttccggctggctggtttattgctgataaatctgg
agccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatg
gtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaact
atggatgaacgaaatagacagatcgctgagataggtgcctcactgattaa
gcattggtaactgtcagaccaagtttactcatatatactttagattgatt
taaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgat
aatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtc
agaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgc
gcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtt
tgtttgccggatcaagagctaccaactctttttccgaaggtaactggctt
cagcagagcgcagataccaaatactgttcttctagtgtagccgtagttag
gccaccacttcaagaactctgtagcaccgcctacatacctcgctctgcta
atcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgg
gttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaa
cggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaa
ctgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagg
gagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagc
gcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtc
gggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcagg
ggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcc
tggccttttgctggccttttgctcacatgttctttcctgcgttatcccct
gattctgtggataaccgtattaccgcctttgagtgagctgataccgctcg
ccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaag
agcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaa
tgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaa
cgcaattaatgtgagttagctcactcattaggcaccccaggctttacact
ttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaattt
cacacaggaaacagctatgaccatgattacgccaagcgcgcaattaaccc
tcactaaagggaacaaaagctggagctgcaagcttaatgtagtcttatgc
aatactcttgtagtcttgcaacatggtaacgatgagttagcaacatgcct
tacaaggagagaaaaagcaccgtgcatgccgattggtggaagtaaggtgg
tacgatcgtgccttattaggaaggcaacagacgggtctgacatggattgg
acgaaccactgaattgccgcattgcagagatattgtatttaagtgcctag
ctcgatacataaacgggtctctctggttagaccagatctgagcctgggag
ctctctggctaactagggaacccactgcttaagcctcaataaagcttgcc
ttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgactctggtaact
agagatccctcagacccttttagtcagtgtggaaaatctctagcagtggc
gcccgaacagggacttgaaagcgaaagggaaaccagaggagctctctcga
cgcaggactcggcttgctgaagcgcgcacggcaagaggcgaggggcggcg
actggtgagtacgccaaaaattttgactagcggaggctagaaggagagag
atgggtgcgagagcgtcagtattaagcgggggagaattagatcgcgatgg
gaaaaaattcggttaaggccagggggaaagaaaaaatataaattaaaaca
tatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcc
tgttagaaacatcagaaggctgtagacaaatactgggacagctacaacca
tcccttcagacaggatcagaagaacttagatcattatataatacagtagc
aaccctctattgtgtgcatcaaaggatagagataaaagacaccaaggaag
ctttagacaagatagaggaagagcaaaacaaaagtaagaccaccgcacag
caagcggccgctgatcttcagacctggaggaggagatatgagggacaatt
ggagaagtgaattatataaatataaagtagtaaaaattgaaccattagga
gtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagc
agtgggaataggagctttgttccttgggttcttgggagcagcaggaagca
ctatgggcgcagcgtcaatgacgctgacggtacaggccagacaattattg
tctggtatagtgcagcagcagaacaatttgctgagggctattgaggcgca
acagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaa
gaatcctggctgtggaaagatacctaaaggatcaacagctcctggggatt
tggggttgctctggaaaactcatttgcaccactgctgtgccttggaatgc
tagttggagtaataaatctctggaacagatttggaatcacacgacctgga
tggagtgggacagagaaattaacaattacacaagcttaatacactcctta
attgaagaatcgcaaaaccagcaagaaaagaatgaacaagaattattgga
attagataaatgggcaagtttgtggaattggtttaacataacaaattggc
tgtggtatataaaattattcataatgatagtaggaggcttggtaggttta
agaatagtttttgctgtactttctatagtgaatagagttaggcagggata
ttcaccattatcgtttcagacccacctcccaaccccgaggggacccgaca
ggcccgaaggaatagaagaagaaggtggagagagagacagagacagatcc
attcgattagtgaacggatctcgacggtatcgatcacgagactagcctcg
agcggccgcccccttcaccgagggcctatttcccatgattccttcatatt
tgcatatacgatacaaggctgttagagagataattggaattaatttgact
gtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatt
tcttgggtagtttgcagttttaaaattatgttttaaaatggactatcata
tgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttg
tggaaaggacgaaacaccggtgaattctcgacctcgagacaaatggcagt
attcatccacaattttaaaagaaaaggggggattggggggtacagtgcag
gggaaagaatagtagacataatagcaacagacatacaaactaaagaatta
caaaaacaaattacaaaaattcaaaattttcgggtttattacagggacag
cagagatccactttggccgcggctcgaggggg