Return to Web Version
Sigma-Aldrich
Life Science > Functional Genomics & RNAi > shRNA > Learning Center > MISSION® Application Data > Utility of shRNA Clones
shRNA

Utility of shRNA Clones


Data courtesy of Kevin Glenn, M.D., Carver College of Medicine at the University of Iowa


A complimentary approach to overexpression experiments is to observe the effects of F-Box Protein 6 (i.e. FBG2 or FBXO6) specific suppression on A1AT * levels. A panel of FBG2 specific shRNA plasmids (RefSeq NM_018438, see Table 1) was transfected into COS-7 cells in equimolar amounts with a FLAG-tagged FBG2 expression plasmid.

*Note: A1AT is also known as serpin peptidase inhibitor, clade A (alpha-1antiproteinase, antitrypsin), member 1 (SERPINA1).


Table 1. Clones for RefSeq NM_018438
TRC Clone Number Target Region Sequence
TRCN0000007731 3UTR CCGGTGTGGTAACTTACTGTCACATCTCGAGATGTGACAGTAAGTTACCACATTTTT
TRCN0000007732 CDS CCGGGCATGGCAAATTGATTTCAATCTCGAGATTGAAATCAATTTGCCATGCTTTTT
TRCN0000007733 CDS CCGGTGTGCTGAAGAGGATATGTTTCTCGAGAAACATATCCTCTTCAGCACATTTTT
TRCN0000007734 CDS CCGGCCTACGAAATGTGCCTCAAGTCTCGAGACTTGAGGCACATTTCGTAGGTTTTT

Total cell lysates were prepared and probed via Western blotting using Anti-FLAG™ and anti-tubulin antibodies. Compared to shRNA-7731 (a negative control shRNA that is targeted to the 3’ UTR), shRNA-7732 achieved significant suppression, while shRNAs-7733 and -7734 achieved modest suppression (Figure 1). This proof of principle experiment demonstrates that shRNAs are likely to be effective in suppressing FBG2 expression.


Western blot of COS-7 cell lysates from cotransfections of FLAG-FBG2 and MISSION® TRC shRNA plasmids

Figure 1. Western blot of COS-7 cell lysates from co-transfections of FLAG-FBG2 and MISSION® TRC shRNA plasmids. Total cell lysates were probed with indicated antibodies.


3’ UTR shRNA constructs not only serve a role as ideal negative controls in overexpression experiments, they also are pertinent to cDNA rescue experiments. In studies where the endogenous protein is knocked down via stable shRNA expression, the phenotype may be rescued by expression of cDNA constructs. 3’UTR hairpins will not target the exogenous copy of the protein. Thus, the phenotype of the cell may be rescued validating that the effect seen is in fact due to targeted gene silencing.


Contact Us
For questions about the library, pricing and quotes or other concerns, please e-mail us at: RNAi@sial.com.



MISSION is a trademark of Sigma-Aldrich. Label License.

back to top
back to Application Data
shRNA Homepage
RNAi Homepage

your favorite gene search

powered by ingenuity

Service & Support
Ordering
Corporate

©2011 Sigma-Aldrich Co. LLC. All rights reserved. SIGMA, SAFC, SIGMA-ALDRICH, ALDRICH, and SUPELCO are trademarks of Sigma-Aldrich Co. LLC, registered in the US and other countries. FLUKA is a trademark of Sigma-Aldrich GmbH, registered in the US and other countries. Sigma brand products are sold through Sigma-Aldrich, Inc. Purchaser must determine the suitability of the product(s) for their particular use. Additional terms and conditions may apply. Site Use Terms | Privacy

  • YouTube
  • Twitter
  • LinkedIN
  • Facebook