Sequencing Primers

We have designed a range of forward and reverse sequencing primers that allow you to sequence any insert that you make into a particular position within any of our SnapFast™ expression vectors. Other vectors will require that you design your own primers. Where possible, the binding sites for each of these primers is conserved. Each primer has been designed to the following parameters:

GC content: 50-55 %
Melting point (TM): 55-60°C
Base Pairs (BP): 18-22 nucleotides
Primer dimer: No
2ndry structure: None-Weak


Please click on the relevant restriction site to find primers that flank that region for sequencing.

AsiSI
Bgl2
NotI
HindIII
SacI
EcoRI
KpnI
NcoI
EcoRV
XhoI
XbaI
ClaI
BamHI
StuI
NheI
SbfI
PacI
SwaI
FseI
AscI
PmeI

Sequencing inserts in the Bgl2 site:

Forward BglII (primer binds between AsiSI and Bgl2 and reads towards Bgl2)
Primer name: OGP-F1  
Sequence: TCGTTGCGTTACACACAC
TM: 59°C
BP: 18
GC: 50%
Dimer: No
2ndry structure: None

Reverse Bgl II (primer binds between NotI and Bgl2 and reads towards Bgl2)
Primer name: OGP-R1
Sequence: TGTGTCGAGTGGATGGTAG
TM: 59.67°C
BP: 19
GC: 52.6%
Dimer: No
2ndry structure: None

Sequencing inserts between NotI – XbaI (sequences the MCS):

Forward NotI-XbaI (primer binds between BglII and NotI and reads towards NotI)
Primer name: OGP-F2
Sequence: TGTCGATCCTACCATCCA
TM: 60°C
BP: 18
GC: 50%
Dimer: No
2ndry structure: Very weak

Reverse XbaI-NotI (primer binds between CIaI and XbaI and reads towards XbaI)
Primer name: OGP-R2
Sequence: AGTCAGTCAGTGCAGGAG
TM: 56°C
BP: 18
GC: 55%
Dimer: No
2ndry structure: None

Sequencing inserts between ClaI – NheI (sequences the fusion MCS):

Forward ClaI-NheI (primer binds between XbaI and BsgI and reads towards BsgI)
Primer name: OGP-F3
Sequence: AGTTGTCTCCTCCTGCACT
TM: 58.97°C
BP: 19
GC: 53%
Dimer: No
2ndry structure: Very weak

Reverse NheI-ClaI (primer binds between SbfI and NheI and reads towards NheI)
Primer name: OGP-R3
Sequence: AGCTGAAGGTACGCTGTATC
TM: 58.53°C
BP: 20
GC: 50%
Dimer: No
2ndry structure: Weak

Sequencing inserts in the SbfI site:

Forward SbfI (primer binds between NheI and SbfI and reads towards SbfI). These primer sequences were changed in January 2014 because in some plasmids low level homology was causing mixed reads.
Primer name: OGP-F4
Sequence: GGATTGCTATCTACCGG
TM: 55°C
BP: 17
GC: 53%
Dimer: No
2ndry structure: None

Reverse SbfI (primer binds between PacI and SbfI and reads towards SbfI)
Primer name: OGP-R4
Sequence: CCAAGGTAACCAATGAG
TM: 53°C
BP: 17
GC: 47%
Dimer: No
2ndry structure: None

Sequencing inserts in the PacI site:

Forward PacI (primer binds between SbfI and PacI and reads towards PacI)
Primer name: OGP-F5
Sequence: CTCATTGGTTACCTTGGG
TM: 57.8°C
BP: 18
GC: 50%
Dimer: No
2ndry structure: None

Reverse PacI (primer binds between SwaI and PacI and reads towards PacI)
Primer name: OGP-R5
Sequence: ACAAGTCGATCTCGCCAA
TM: 62°C
BP: 18
GC: 50%
Dimer: No
2ndry structure: None

Sequencing inserts in the SwaI site:

Forward SwaI (primer binds between PacI and SwaI and reads towards SwaI)
Primer name: OGP-F6
Sequence: TGGTCCTTGCTATTGCAC
TM: 59.79°C
BP: 18
GC: 50%
Dimer: No
2ndry structure: Weak

Reverse SwaI (primer binds between FseI and SwaI and reads towards SwaI)
Primer name: OGP-R6
Sequence: CAAGATGGATCGGACGAA
TM: 62°C
BP: 18
GC: 50%
Dimer: No
2ndry structure: None

Sequencing inserts in the FseI site:

Forward FseI (primer binds between SwaI and FseI and reads towards FseI)
Primer name: OGP-F7
Sequence: GATCCATCTTGCAGGCTAC
TM: 59.78°C
BP: 19
GC: 53%
Dimer: No
2ndry structure: None

Reverse FseI (primer binds between AscI and FseI and reads towards FseI)
Primer name: OGP-R7
Sequence: GGAGTAATACCTGGCGATAG
TM: 57.7°C
BP: 20
GC: 50%
Dimer: No
2ndry structure: None

Sequencing inserts in the AscI site:

Forward AscI (primer binds between FseI and AscI and reads towards AscI)
Primer name: OGP-F8
Sequence: TCCCGATCTATCCGAGAT
TM: 59.51°C
BP: 18
GC: 50%
Dimer: No
2ndry structure: Weak

Reverse AscI (primer binds between PmeI and AscI and reads towards AscI)
Primer name: OGP-R8
Sequence: ATCGTCGAGACTCGCAC
TM: 61.24°C
BP: 18
GC: 55%
Dimer: No
2ndry structure: Weak

Sequencing inserts in the PmeI site:

Forward PmeI (primer binds between AscI and PmeI and reads towards PmeI)
Primer name: OGP-F9
Sequence: CAGGAAGTCCAATCGTCAG
TM: 60.85°C
BP: 19
GC: 53%
Dimer: No
2ndry structure: None

Reverse PmeI (primer binds between AsiSI and PmeI and reads towards PmeI)
Primer name: OGP-R9
Sequence: CTCGAAACGACGGAGATT
TM: 60.3°C
BP: 18
GC: 50%
Dimer: No
2ndry structure: Weak

Sequencing inserts in the AsiSI site:

Forward AsiSI (primer binds between PmeI and AsiSI and reads towards AsiSI)
Primer name: OGP-F10
Sequence: GAATCTCGTCAGCTATCGTC
TM: 58.97°C
BP: 20
GC: 50%
Dimer: No
2ndry structure: None

Reverse AsiSI (primer binds between BglII and AsiSI and reads towards AsiSI)
Primer name: OGP-R10
Sequence: CCTGTGGAGCTAATGGTC
TM: 58°C
BP: 18
GC: 55%
Dimer: No
2ndry structure: None

Materials

Plasmid Product Name Product No. Application
Most Popular Bacterial Reporter Genes
pSF-OXB20-BetaGal
OGS207 RecA promoter driving b-galactosidase
pSF-OXB20-Fluc OGS412 OXB20 promoter driving firefly luciferase
Most Popular Bacterial Promoters
pSF-OXB20
OGS50 OXB20 promoter (strongest expression)
pSF-OXB1 OGS553 OXB1 promoter (weakest expression)
pSF-T7/LacO OGS500 T7 promoter with lac operon (inducible expression)
pSF-Tac OGS501 Tac promoter (IPTG inducible expression)
pSF-LacI OGS502 LacI promoter (regulated expression)
Most Popular Mammalian Reporter Genes
pSF-CMV-PGK-Fluc OGS388 Dual promoters driving  firefly luciferase
pSF-CMV-RLuc OGS103 CMV promoter driving sea pansy luciferase
pSF-CMV-Ub-BetaGal AscI OGS158 Dual promoters driving b-galactosidase
pSF-CMV-FMDV-daGFP OGS289 Dual promoters driving IRES daGFP
pSF-CMV-RSV-SEAP AscI OGS17 Dual promoters driving SEAP
Most Popular Mammalian Promoters
pSF-CMV-Kan OGS10 CMV promoter (strongest expression)
pSF-CAG-Kan OGS505 Synthetic CAG promoter (strong and stable expression)
pSF-EF1 Alpha OGS43 EF1a promoter (moderate but stable expression)
Most Popular Mammalian Selection Markers
pSF-CMV-PGK-Puro OGS394 Dual promoter for expressing two genes (puromycin)
pSF-CMV-FMDV-Hygro OGS292 Dual promoter expressing one gene (hygromycin)
pSF-CMV-Blast OGS588 CMV promoter (blasticidin)
pSF-CMV-Ub-Neo/G418 AscI OGS22 Dual promoter expressing one gene (G418)
Most Popular Mammalian Protein Tags
pSF-CMV-Puro-NH2-10His-EKT OGS1157 N-term 10His affinity tag & EKT cleavage tag
pSF-CMV-Puro-NH2-FLAG®-6His-EKT OGS1175 N-term FLAG®, 6His affinity tags & EKT cleavage tag
pSF-CMV-Puro-COOH-TEV-10His OGS1120 C-term 10His affinity tag & TEV cleavage tag
pSF-CMV-Puro-COOH-TEV-FLAG®-6His OGS1232 C-term FLAG®, 6His affinity tags & TEV cleavage tag
Most Popular Bacterial Protein Tags
pSF-OXB20-NH2-10His-EKT OGS2806 N-term 10His affinity tag & EKT cleavage tag
pSF-OXB20-NH2-FLAG®-6His-EKT OGS2828 N-term FLAG®, 6His affinity tags & EKT cleavage tag
pSF-OXB20-COOH-TEV-10His OGS2767 C-term 10His affinity tag & TEV cleavage tag
pSF-OXB20-COOH-TEV-FLAG®-6His OGS2891 C-term FLAG®, 6His affinity tags & TEV cleavage tag
Most Popular Yeast Protein Tags
pSF-TEF1-NH2-10His-EKT OGS1649 N-term 10His affinity tag & EKT cleavage tag
pSF-TEF1-NH2-FLAG®-6His-EKT OGS1658 N-term FLAG®, 6His affinity tags & EKT cleavage tag
pSF-TEF1-COOH-TEV-10His OGS1913 C-term 10His affinity tag & TEV cleavage tag
pSF-TEF1-COOH-TEV-FLAG®-6His OGS1969 C-term FLAG®, 6His affinity tags & TEV cleavage tag
Other Popular Plasmids
pSF-OXB20-NH2-OmpA OGS3099 Bacterial promoter with N-term Omp secretion signal
pSF-CMV-Puro-NH2-InsulinSP OGS1436 Mammalian promoter with N-term Insulin secretion signal
pSF-CMV-SC101 OGS13 Mammalian promoter with low copy number
pSF-TEF1-NH2-Amy OGS1817 Yeast Promoter with N-term Amy secretion signal
pSF-TEFI-TPI1-Fluc-URA3 OGS545 Yeast promoter driving firefly luciferase (plus URA3 selection)
pSF-Ad5 OGS268 Adenoviral cloning vector
pSF-CMV-CMV-SbfI-Ub-Puro OGS597 Dual CMV promoters for expressing two genes
pSF-PromMCS-FLuc OGS369 Promoterless MCS allows you to insert your choice
Popular Plasmid Sets
Mammalian FLAG® Tag Pack PPS2393 Four plasmids to optimize FLAG® tag use with TEV tag
Mammalian Promoters Pack PPS2356 Six plasmids to optimize expression based on promoter strength
Bacterial FLAG® Tag Pack PPS2394 Four plasmids to optimize FLAG® tag use with TEV tag
Yeast Signal Peptide Pack PPS2381 Nine plasmids to optimize protein secretion signal