[Skip to Content](https://www.sigmaaldrich.com#main-content) [![Merck](https://www.sigmaaldrich.com/static/logos/purple/merck.svg)](https://www.sigmaaldrich.com/AU/en) Products Cart0 AUEN Products ProductsApplicationsServicesResourcesSupport [Login / Register](https://www.sigmaaldrich.com/oidc-sign-in) [Order Lookup](https://www.sigmaaldrich.com/AU/en/order-lookup) [Quick Order](https://www.sigmaaldrich.com/AU/en/quick-order) Cart0 [Home](https://www.sigmaaldrich.com/AU/en)[Sequencing](https://www.sigmaaldrich.com/AU/en/applications/genomics/sequencing)Sequencing Primers # Sequencing Primers We have designed a range of forward and reverse sequencing primers that allow you to sequence any insert that you make into a particular position within any of our SnapFast™ expression vectors. Other vectors will require that you design your own primers. Where possible, the binding sites for each of these primers is conserved. Each primer has been designed to the following parameters: GC content: 50-55 % Melting point (TM): 55-60 °C Base Pairs (BP): 18-22 nucleotides Primer dimer: No 2ndry structure: None-Weak Please click on the relevant restriction site to find primers that flank that region for sequencing: [AsiSI](https://www.sigmaaldrich.com#AsiSI) [Bgl2](https://www.sigmaaldrich.com#Bgl2) [NotI](https://www.sigmaaldrich.com#NotIXbaI) [HindIII](https://www.sigmaaldrich.com#NotIXbaI) [SacI](https://www.sigmaaldrich.com#NotIXbaI) [EcoRI](https://www.sigmaaldrich.com#NotIXbaI) [KpnI](https://www.sigmaaldrich.com#NotIXbaI) [NcoI](https://www.sigmaaldrich.com#NotIXbaI) [EcoRV](https://www.sigmaaldrich.com#NotIXbaI) [XhoI](https://www.sigmaaldrich.com#NotIXbaI) [XbaI](https://www.sigmaaldrich.com#NotIXbaI) [ClaI](https://www.sigmaaldrich.com#ClaINheI) [BamHI](https://www.sigmaaldrich.com#ClaINheI) [StuI](https://www.sigmaaldrich.com#ClaINheI) [NheI](https://www.sigmaaldrich.com#ClaINheI) [SbfI](https://www.sigmaaldrich.com#SbfI) [PacI](https://www.sigmaaldrich.com#PacI) [SwaI](https://www.sigmaaldrich.com#SwaI) [FseI](https://www.sigmaaldrich.com#FseI) [AscI](https://www.sigmaaldrich.com#AscI) [PmeI](https://www.sigmaaldrich.com#PmeI) ![Forward Sequencing Primers](https://www.sigmaaldrich.com/content/dam/cms-commons/sigmaaldrich/marketing/global/images/technical-documents/articles/genomics/sequencing/forward-primer-binding-sites.jpg "Forward Sequencing Primers") ![Reverse Sequencing Primers](https://www.sigmaaldrich.com/content/dam/cms-commons/sigmaaldrich/marketing/global/images/technical-documents/articles/genomics/sequencing/reverse-primer-binding-sites.jpg "Reverse Sequencing Primers") ## [](https://www.sigmaaldrich.com)Sequencing inserts in the Bgl2 site: Forward BglII (primer binds between AsiSI and Bgl2 and reads towards Bgl2) Primer name: __OGP-F1__ [](http://oxfordgenetics.com/plasmid-products/-detail)  Sequence: TCGTTGCGTTACACACAC TM: 59 °C BP: 18 GC: 50% Dimer: No 2ndry structure: None Reverse Bgl II (primer binds between NotI and Bgl2 and reads towards Bgl2) Primer name: __OGP-R1__ Sequence: TGTGTCGAGTGGATGGTAG TM: 59.67 °C BP: 19 GC: 52.6% Dimer: No 2ndry structure: None ## [](https://www.sigmaaldrich.com)Sequencing inserts between NotI – XbaI (sequences the MCS): Forward NotI-XbaI (primer binds between BglII and NotI and reads towards NotI) Primer name: __OGP-F2__ Sequence: TGTCGATCCTACCATCCA TM: 60 °C BP: 18 GC: 50% Dimer: No 2ndry structure: Very weak Reverse XbaI-NotI (primer binds between CIaI and XbaI and reads towards XbaI) Primer name: __OGP-R2__ Sequence: AGTCAGTCAGTGCAGGAG TM: 56 °C BP: 18 GC: 55% Dimer: No 2ndry structure: None ## [](https://www.sigmaaldrich.com)Sequencing inserts between ClaI – NheI (sequences the fusion MCS): Forward ClaI-NheI (primer binds between XbaI and BsgI and reads towards BsgI) Primer name: __OGP-F3__ Sequence: AGTTGTCTCCTCCTGCACT TM: 58.97 °C BP: 19 GC: 53% Dimer: No 2ndry structure: Very weak Reverse NheI-ClaI (primer binds between SbfI and NheI and reads towards NheI) Primer name: __OGP-R3__ Sequence: AGCTGAAGGTACGCTGTATC TM: 58.53 °C BP: 20 GC: 50% Dimer: No 2ndry structure: Weak ## [](https://www.sigmaaldrich.com)Sequencing inserts in the SbfI site: Forward SbfI (primer binds between NheI and SbfI and reads towards SbfI). These primer sequences were changed in January 2014 because in some plasmids low level homology was causing mixed reads. Primer name: __OGP-F4__ Sequence: GGATTGCTATCTACCGG TM: 55 °C BP: 17 GC: 53% Dimer: No 2ndry structure: None Reverse SbfI (primer binds between PacI and SbfI and reads towards SbfI) Primer name: __OGP-R4__ Sequence: CCAAGGTAACCAATGAG TM: 53 °C BP: 17 GC: 47% Dimer: No 2ndry structure: None ## [](https://www.sigmaaldrich.com)Sequencing inserts in the PacI site: Forward PacI (primer binds between SbfI and PacI and reads towards PacI) Primer name: __OGP-F5__ Sequence: CTCATTGGTTACCTTGGG TM: 57.8 °C BP: 18 GC: 50% Dimer: No 2ndry structure: None Reverse PacI (primer binds between SwaI and PacI and reads towards PacI) Primer name: __OGP-R5__ Sequence: ACAAGTCGATCTCGCCAA TM: 62 °C BP: 18 GC: 50% Dimer: No 2ndry structure: None ## [](https://www.sigmaaldrich.com)Sequencing inserts in the SwaI site: Forward SwaI (primer binds between PacI and SwaI and reads towards SwaI) Primer name: __OGP-F6__ Sequence: TGGTCCTTGCTATTGCAC TM: 59.79 °C BP: 18 GC: 50% Dimer: No 2ndry structure: Weak Reverse SwaI (primer binds between FseI and SwaI and reads towards SwaI) Primer name: __OGP-R6__ Sequence: CAAGATGGATCGGACGAA TM: 62 °C BP: 18 GC: 50% Dimer: No 2ndry structure: None ## [](https://www.sigmaaldrich.com)Sequencing inserts in the FseI site: Forward FseI (primer binds between SwaI and FseI and reads towards FseI) Primer name: __OGP-F7__ Sequence: GATCCATCTTGCAGGCTAC TM: 59.78 °C BP: 19 GC: 53% Dimer: No 2ndry structure: None Reverse FseI (primer binds between AscI and FseI and reads towards FseI) Primer name: __OGP-R7__ Sequence: GGAGTAATACCTGGCGATAG TM: 57.7 °C BP: 20 GC: 50% Dimer: No 2ndry structure: None ## [](https://www.sigmaaldrich.com)Sequencing inserts in the AscI site: Forward AscI (primer binds between FseI and AscI and reads towards AscI) Primer name: __OGP-F8__ Sequence: TCCCGATCTATCCGAGAT TM: 59.51 °C BP: 18 GC: 50% Dimer: No 2ndry structure: Weak Reverse AscI (primer binds between PmeI and AscI and reads towards AscI) Primer name: __OGP-R8__ Sequence: ATCGTCGAGACTCGCAC TM: 61.24 °C BP: 18 GC: 55% Dimer: No 2ndry structure: Weak ## [](https://www.sigmaaldrich.com)Sequencing inserts in the PmeI site: Forward PmeI (primer binds between AscI and PmeI and reads towards PmeI) Primer name: __OGP-F9__ Sequence: CAGGAAGTCCAATCGTCAG TM: 60.85 °C BP: 19 GC: 53% Dimer: No 2ndry structure: None Reverse PmeI (primer binds between AsiSI and PmeI and reads towards PmeI) Primer name: __OGP-R9__ Sequence: CTCGAAACGACGGAGATT TM: 60.3 °C BP: 18 GC: 50% Dimer: No 2ndry structure: Weak ## [](https://www.sigmaaldrich.com)Sequencing inserts in the AsiSI site: Forward AsiSI (primer binds between PmeI and AsiSI and reads towards AsiSI) Primer name: __OGP-F10__ Sequence: GAATCTCGTCAGCTATCGTC TM: 58.97 °C BP: 20 GC: 50% Dimer: No 2ndry structure: None Reverse AsiSI (primer binds between BglII and AsiSI and reads towards AsiSI) Primer name: __OGP-R10__ Sequence: CCTGTGGAGCTAATGGTC TM: 58 °C BP: 18 GC: 55% Dimer: No 2ndry structure: None | | | | |----------------------------------------------|---------------------------------------------------------------------|-----------------------------------------------------------------| | Plasmid Product Name | Product No. | Application | | __Most Popular Bacterial Reporter Genes__ | | | | pSF-OXB20-BetaGal | [OGS207](https://www.sigmaaldrich.com/AU/en/product/SIGMA/OGS207) | RecA promoter driving b-galactosidase | | pSF-OXB20-Fluc | [OGS412](https://www.sigmaaldrich.com/AU/en/product/SIGMA/OGS412) | OXB20 promoter driving firefly luciferase | | __Most Popular Bacterial Promoters__ | | | | pSF-OXB20 | [OGS50](https://www.sigmaaldrich.com/AU/en/product/SIGMA/OGS50) | OXB20 promoter (strongest expression) | | pSF-OXB1 | [OGS553](https://www.sigmaaldrich.com/AU/en/product/SIGMA/OGS553) | OXB1 promoter (weakest expression) | | pSF-T7/LacO | [OGS500](https://www.sigmaaldrich.com/AU/en/product/SIGMA/OGS500) | T7 promoter with lac operon (inducible expression) | | pSF-Tac | [OGS501](https://www.sigmaaldrich.com/AU/en/product/SIGMA/OGS501) | Tac promoter (IPTG inducible expression) | | pSF-LacI | [OGS502](https://www.sigmaaldrich.com/AU/en/product/SIGMA/OGS502) | LacI promoter (regulated expression) | | __Most Popular Mammalian Reporter Genes__ | | | | pSF-CMV-PGK-Fluc | [OGS388](https://www.sigmaaldrich.com/AU/en/product/SIGMA/OGS388) | Dual promoters driving  firefly luciferase | | pSF-CMV-RLuc | [OGS103](https://www.sigmaaldrich.com/AU/en/product/sigma/ogs103) | CMV promoter driving sea pansy luciferase | | pSF-CMV-Ub-BetaGal AscI | OGS158 | Dual promoters driving b-galactosidase | | pSF-CMV-FMDV-daGFP | OGS289 | Dual promoters driving IRES daGFP | | pSF-CMV-RSV-SEAP AscI | [OGS17](https://www.sigmaaldrich.com/AU/en/product/SIGMA/OGS17) | Dual promoters driving SEAP | | __Most Popular Mammalian Promoters__ | | | | pSF-CMV-Kan | [OGS10](https://www.sigmaaldrich.com/AU/en/product/SIGMA/OGS10) | CMV promoter (strongest expression) | | pSF-CAG-Kan | [OGS505](https://www.sigmaaldrich.com/AU/en/product/SIGMA/OGS505) | Synthetic CAG promoter (strong and stable expression) | | pSF-EF1 Alpha | [OGS43](https://www.sigmaaldrich.com/AU/en/product/SIGMA/OGS43) | EF1a promoter (moderate but stable expression) | | __Most Popular Mammalian Selection Markers__ | | | | pSF-CMV-PGK-Puro | [OGS394](https://www.sigmaaldrich.com/AU/en/product/SIGMA/OGS394) | Dual promoter for expressing two genes (puromycin) | | pSF-CMV-FMDV-Hygro | [OGS292](https://www.sigmaaldrich.com/AU/en/product/SIGMA/OGS292) | Dual promoter expressing one gene (hygromycin) | | pSF-CMV-Blast | [OGS588](https://www.sigmaaldrich.com/AU/en/product/SIGMA/OGS588) | CMV promoter (blasticidin) | | pSF-CMV-Ub-Neo/G418 AscI | [OGS22](https://www.sigmaaldrich.com/AU/en/product/SIGMA/OGS22) | Dual promoter expressing one gene (G418) | | __Most Popular Mammalian Protein Tags__ | | | | pSF-CMV-Puro-NH2-10His-EKT | [OGS1157](https://www.sigmaaldrich.com/AU/en/product/SIGMA/OGS1157) | N-term 10His affinity tag & EKT cleavage tag | | pSF-CMV-Puro-NH2-FLAG®-6His-EKT | [OGS1175](https://www.sigmaaldrich.com/AU/en/product/SIGMA/OGS1175) | N-term FLAG®, 6His affinity tags & EKT cleavage tag | | pSF-CMV-Puro-COOH-TEV-10His | [OGS1120](https://www.sigmaaldrich.com/AU/en/product/SIGMA/OGS1120) | C-term 10His affinity tag & TEV cleavage tag | | pSF-CMV-Puro-COOH-TEV-FLAG®-6His | [OGS1232](https://www.sigmaaldrich.com/AU/en/product/SIGMA/OGS1232) | C-term FLAG®, 6His affinity tags & TEV cleavage tag | | __Most Popular Bacterial Protein Tags__ | | | | pSF-OXB20-NH2-10His-EKT | [OGS2806](https://www.sigmaaldrich.com/AU/en/product/SIGMA/OGS2806) | N-term 10His affinity tag & EKT cleavage tag | | pSF-OXB20-NH2-FLAG®-6His-EKT | [OGS2828](https://www.sigmaaldrich.com/AU/en/product/SIGMA/OGS2828) | N-term FLAG®, 6His affinity tags & EKT cleavage tag | | pSF-OXB20-COOH-TEV-10His | [OGS2767](https://www.sigmaaldrich.com/AU/en/product/SIGMA/OGS2767) | C-term 10His affinity tag & TEV cleavage tag | | pSF-OXB20-COOH-TEV-FLAG®-6His | [OGS2891](https://www.sigmaaldrich.com/AU/en/product/SIGMA/OGS2891) | C-term FLAG®, 6His affinity tags & TEV cleavage tag | | __Most Popular Yeast Protein Tags__ | | | | pSF-TEF1-NH2-10His-EKT | [OGS1649](https://www.sigmaaldrich.com/AU/en/product/SIGMA/OGS1649) | N-term 10His affinity tag & EKT cleavage tag | | pSF-TEF1-NH2-FLAG®-6His-EKT | [OGS1658](https://www.sigmaaldrich.com/AU/en/product/SIGMA/OGS1658) | N-term FLAG®, 6His affinity tags & EKT cleavage tag | | pSF-TEF1-COOH-TEV-10His | [OGS1913](https://www.sigmaaldrich.com/AU/en/product/SIGMA/OGS1913) | C-term 10His affinity tag & TEV cleavage tag | | pSF-TEF1-COOH-TEV-FLAG®-6His | [OGS1969](https://www.sigmaaldrich.com/AU/en/product/SIGMA/OGS1969) | C-term FLAG®, 6His affinity tags & TEV cleavage tag | | __Other Popular Plasmids__ | | | | pSF-OXB20-NH2-OmpA | [OGS3099](https://www.sigmaaldrich.com/AU/en/product/SIGMA/OGS3099) | Bacterial promoter with N-term Omp secretion signal | | pSF-CMV-Puro-NH2-InsulinSP | [OGS1436](https://www.sigmaaldrich.com/AU/en/product/SIGMA/OGS1436) | Mammalian promoter with N-term Insulin secretion signal | | pSF-CMV-SC101 | [OGS13](https://www.sigmaaldrich.com/AU/en/product/SIGMA/OGS13) | Mammalian promoter with low copy number | | pSF-TEF1-NH2-Amy | OGS1817 | Yeast Promoter with N-term Amy secretion signal | | pSF-TEFI-TPI1-Fluc-URA3 | [OGS545](https://www.sigmaaldrich.com/AU/en/product/SIGMA/OGS545) | Yeast promoter driving firefly luciferase (plus URA3 selection) | | pSF-Ad5 | [OGS268](https://www.sigmaaldrich.com/AU/en/product/SIGMA/OGS268) | Adenoviral cloning vector | | pSF-CMV-CMV-SbfI-Ub-Puro | [OGS597](https://www.sigmaaldrich.com/AU/en/product/SIGMA/OGS597) | Dual CMV promoters for expressing two genes | | pSF-PromMCS-FLuc | [OGS369](https://www.sigmaaldrich.com/AU/en/product/SIGMA/OGS369) | Promoterless MCS allows you to insert your choice | | __Popular Plasmid Sets__ | | | | Mammalian FLAG® Tag Pack | PPS2393 | Four plasmids to optimize FLAG® tag use with TEV tag | | Mammalian Promoters Pack | [PPS2356](https://www.sigmaaldrich.com/AU/en/product/sigma/pp2356) | Six plasmids to optimize expression based on promoter strength | | Bacterial FLAG® Tag Pack | [PPS2394](https://www.sigmaaldrich.com/AU/en/product/sigma/pp2394) | Four plasmids to optimize FLAG® tag use with TEV tag | | Yeast Signal Peptide Pack | [PPS2381](https://www.sigmaaldrich.com/AU/en/product/sigma/pp2381) | Nine plasmids to optimize protein secretion signal | Materials ## Materials Sorry, an unexpected error has occurred Response not successful: Received status code 500 __Related Articles__ - [Validating CRISPR/Cas9-mediated Gene Editing](https://www.sigmaaldrich.com/AU/en/technical-documents/technical-article/genomics/advanced-gene-editing/validating-crispr-cas9-mediated-gene-editing) - [Ultrapure vs. DEPC Treated Water for Molecular Biology Applications](https://www.sigmaaldrich.com/AU/en/technical-documents/technical-article/genomics/dna-and-rna-purification/nuclease-free-water) - [Water for Next-Generation Sequencing](https://www.sigmaaldrich.com/AU/en/technical-documents/technical-article/genomics/next-gen-sequencing/water-for-next-generation-sequencing) - [Amino Acid Codon Wheel](https://www.sigmaaldrich.com/AU/en/technical-documents/technical-article/genomics/sequencing/amino-acid-codon-wheel) - [MULTI-seq Sample Multiplexing for Single Cell Analysis and Sequencing](https://www.sigmaaldrich.com/AU/en/technical-documents/technical-article/genomics/sequencing/multi-seq-sample-multiplexing-single-cell-analysis-sequencing) - [Ultrapure Water for DNA Sequencing](https://www.sigmaaldrich.com/AU/en/technical-documents/technical-article/genomics/sequencing/water-dna-sequencing) __Related Product Categories__ - [Molecular Cloning & Protein Expression](https://www.sigmaaldrich.com/AU/en/products/molecular-biology-and-functional-genomics/cloning-and-expression/molecular-cloning-and-protein-expression) Top __Sign In To Continue__ To continue reading please sign in or create an account. Sign In__Don't Have An Account?__Register An unknown error has occured.